Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   KJP59_RS02560 Genome accession   NZ_OX419570
Coordinates   484738..484860 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis isolate NRS6134     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 479738..489860
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  KJP59_RS02545 (NRS6134_02535) yclJ 481352..482035 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  KJP59_RS02550 (NRS6134_02540) yclK 482022..483443 (+) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  KJP59_RS02555 (NRS6134_02545) rapC 483606..484754 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  KJP59_RS02560 (NRS6134_02550) phrC 484738..484860 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  KJP59_RS02565 (NRS6134_02555) yczM 484960..485049 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  KJP59_RS02570 (NRS6134_02560) yczN 485131..485244 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  KJP59_RS02575 (NRS6134_02565) thrD 485398..486762 (-) 1365 WP_003234493.1 aspartate kinase -
  KJP59_RS02580 (NRS6134_02570) ceuB 487147..488097 (+) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  KJP59_RS02585 (NRS6134_02575) yclO 488090..489037 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  KJP59_RS02590 (NRS6134_02580) yclP 489031..489789 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=1040396 KJP59_RS02560 WP_003224994.1 484738..484860(+) (phrC) [Bacillus subtilis isolate NRS6134]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=1040396 KJP59_RS02560 WP_003224994.1 484738..484860(+) (phrC) [Bacillus subtilis isolate NRS6134]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment