Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   AB3239_RS02130 Genome accession   NZ_CP166831
Coordinates   420123..420245 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain TE3T-UV25     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 415123..425245
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  AB3239_RS02115 (AB3239_02115) yclJ 416737..417420 (+) 684 WP_015482792.1 two-component system response regulator YclJ -
  AB3239_RS02120 (AB3239_02120) yclK 417407..418828 (+) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  AB3239_RS02125 (AB3239_02125) rapC 418991..420139 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  AB3239_RS02130 (AB3239_02130) phrC 420123..420245 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  AB3239_RS02135 (AB3239_02135) yczM 420345..420434 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  AB3239_RS02140 (AB3239_02140) yczN 420516..420629 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  AB3239_RS02145 (AB3239_02145) thrD 420782..422146 (-) 1365 WP_021481755.1 aspartate kinase -
  AB3239_RS02150 (AB3239_02150) ceuB 422531..423481 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  AB3239_RS02155 (AB3239_02155) yclO 423474..424421 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  AB3239_RS02160 (AB3239_02160) yclP 424415..425173 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=1035501 AB3239_RS02130 WP_003224994.1 420123..420245(+) (phrC) [Bacillus subtilis strain TE3T-UV25]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=1035501 AB3239_RS02130 WP_003224994.1 420123..420245(+) (phrC) [Bacillus subtilis strain TE3T-UV25]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment