Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   AB1F75_RS18650 Genome accession   NZ_CP160396
Coordinates   3610711..3610833 (-) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis subsp. subtilis strain BSP1     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 3605711..3615833
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  AB1F75_RS18620 (AB1F75_18620) yclP 3605783..3606541 (-) 759 WP_015252819.1 petrobactin ABC transporter ATP-binding protein YclP -
  AB1F75_RS18625 (AB1F75_18625) yclO 3606535..3607482 (-) 948 WP_015252820.1 petrobactin ABC transporter permease YclO -
  AB1F75_RS18630 (AB1F75_18630) yclN 3607475..3608426 (-) 952 Protein_3655 petrobactin ABC transporter permease YclN -
  AB1F75_RS18635 (AB1F75_18635) thrD 3608810..3610174 (+) 1365 WP_015252822.1 aspartate kinase -
  AB1F75_RS18640 (AB1F75_18640) yczN 3610327..3610440 (+) 114 WP_003234495.1 YjcZ family sporulation protein -
  AB1F75_RS18645 (AB1F75_18645) yczM 3610522..3610611 (+) 90 WP_015482794.1 YjcZ family sporulation protein -
  AB1F75_RS18650 (AB1F75_18650) phrC 3610711..3610833 (-) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  AB1F75_RS18655 (AB1F75_18655) rapC 3610817..3611965 (-) 1149 WP_015252823.1 response regulator aspartate phosphatase RapC Regulator
  AB1F75_RS18660 (AB1F75_18660) yclK 3612129..3613550 (-) 1422 WP_015252824.1 two-component system sensor histidine kinase YclK -
  AB1F75_RS18665 (AB1F75_18665) yclJ 3613537..3614220 (-) 684 WP_015482792.1 two-component system response regulator YclJ -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=1020838 AB1F75_RS18650 WP_003224994.1 3610711..3610833(-) (phrC) [Bacillus subtilis subsp. subtilis strain BSP1]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=1020838 AB1F75_RS18650 WP_003224994.1 3610711..3610833(-) (phrC) [Bacillus subtilis subsp. subtilis strain BSP1]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment