Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   ABYM97_RS06005 Genome accession   NZ_CP159874
Coordinates   1167478..1167600 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain PY79     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 1162478..1172600
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  ABYM97_RS05990 (ABYM97_05990) yclJ 1164092..1164775 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  ABYM97_RS05995 (ABYM97_05995) yclK 1164762..1166183 (+) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  ABYM97_RS06000 (ABYM97_06000) rapC 1166346..1167494 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  ABYM97_RS06005 (ABYM97_06005) phrC 1167478..1167600 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  ABYM97_RS06010 (ABYM97_06010) yczM 1167700..1167789 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  ABYM97_RS06015 (ABYM97_06015) yczN 1167871..1167984 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  ABYM97_RS06020 (ABYM97_06020) thrD 1168138..1169502 (-) 1365 WP_009966541.1 aspartate kinase -
  ABYM97_RS06025 (ABYM97_06025) ceuB 1169887..1170837 (+) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  ABYM97_RS06030 (ABYM97_06030) yclO 1170830..1171777 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  ABYM97_RS06035 (ABYM97_06035) yclP 1171771..1172529 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=1016349 ABYM97_RS06005 WP_003224994.1 1167478..1167600(+) (phrC) [Bacillus subtilis strain PY79]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=1016349 ABYM97_RS06005 WP_003224994.1 1167478..1167600(+) (phrC) [Bacillus subtilis strain PY79]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment