Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   ABI226_RS02195 Genome accession   NZ_CP157216
Coordinates   434206..434328 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis subsp. subtilis isolate FELIX_MS22     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 429206..439328
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  ABI226_RS02180 (ABI226_02180) yclJ 430820..431503 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  ABI226_RS02185 (ABI226_02185) yclK 431490..432911 (+) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  ABI226_RS02190 (ABI226_02190) rapC 433074..434222 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  ABI226_RS02195 (ABI226_02195) phrC 434206..434328 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  ABI226_RS02200 (ABI226_02200) yczM 434428..434517 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  ABI226_RS02205 (ABI226_02205) yczN 434599..434712 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  ABI226_RS02210 (ABI226_02210) thrD 434866..436230 (-) 1365 WP_009966541.1 aspartate kinase -
  ABI226_RS02215 (ABI226_02215) ceuB 436615..437565 (+) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  ABI226_RS02220 (ABI226_02220) yclO 437558..438505 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  ABI226_RS02225 (ABI226_02225) yclP 438499..439257 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=1004805 ABI226_RS02195 WP_003224994.1 434206..434328(+) (phrC) [Bacillus subtilis subsp. subtilis isolate FELIX_MS22]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=1004805 ABI226_RS02195 WP_003224994.1 434206..434328(+) (phrC) [Bacillus subtilis subsp. subtilis isolate FELIX_MS22]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment