Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   ABGT19_RS02150 Genome accession   NZ_CP156993
Coordinates   426102..426224 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain AR03-27     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 421102..431224
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  ABGT19_RS02135 (ABGT19_02135) yclJ 422716..423399 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  ABGT19_RS02140 (ABGT19_02140) yclK 423386..424807 (+) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  ABGT19_RS02145 (ABGT19_02145) rapC 424970..426118 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  ABGT19_RS02150 (ABGT19_02150) phrC 426102..426224 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  ABGT19_RS02155 (ABGT19_02155) yczM 426323..426412 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  ABGT19_RS02160 (ABGT19_02160) yczN 426494..426607 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  ABGT19_RS02165 (ABGT19_02165) thrD 426760..428124 (-) 1365 WP_014478832.1 aspartate kinase -
  ABGT19_RS02170 (ABGT19_02170) ceuB 428515..429465 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  ABGT19_RS02175 (ABGT19_02175) yclO 429458..430405 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  ABGT19_RS02180 (ABGT19_02180) yclP 430399..431157 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=1003680 ABGT19_RS02150 WP_003224994.1 426102..426224(+) (phrC) [Bacillus subtilis strain AR03-27]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=1003680 ABGT19_RS02150 WP_003224994.1 426102..426224(+) (phrC) [Bacillus subtilis strain AR03-27]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment