 ICEberg ID | 79 |
Name  | ICESt3  |
| ICEO ID | ICEO_0000119 |
| Organism | Streptococcus thermophilus CNRZ385 |
| Size (bp) | 28091 |
| GC content [Genome] (%) | 36.9 |
| Insertion site | fda |
| Function | - |
| Species that ICE can be transferred to | Streptococcus pyogenes; Enterococcus faecalis |
| Nucleotide Sequence | AJ586568 (complete ICE sequence in this GenBank file) |
| Replicon | - |
| Coordinates | 204..28293 |
| Putative oriT region | coordinates: 16700..16912; oriTDB id: 200003 CGACGCTTCGAAAGATCATTTATCTCTTGCAAGAACAAGGCATTGTATTCGAACGTTCAGACTCTGCCAT TCTAGTGAATCCTTTTCAAGAAAAACTTCTTCTTGAAATCCTCGCTCAATTTGAAGAGGGAGGACGCAGG TCTTATCCAAAAGCAGTTGAAGCGACGATTGTTCATCATGGGCTAGGACAAGGGCAAGGACAAGCCTGAC CAC |
| Putative relaxase | coordinates: 17116..18348; Family: MOBT |
The Interaction Network among ICE/IME/CIME | ||||||
 | ||||||
| Detailed Informatioin of the Interaction Network | ||||||
| # | ICE | Inter_Ele [Type] | Methods | Donors | Recipients | Exper_Ref |
| 1 | ICESt3 | IME_GB00957_oriT [IME] |  in trans | - | - | - |
| 2 | ICESt3 | CIME19258 [CIME] | in cis | - | - | - |
| 3 | ICESt3 | CIME9 [CIME] | in cis | - | - | - |
| 4 | ICESt3 | CIMEL3catR3 [CIME] | in cis | Streptococcus thermophilus | Streptococcus thermophilus | 21722203 |
| This is an interactioin derived from experimental literature |
| This is a putative interactioin |
The graph information of ICESt3 components from AJ586568 | |||||
 | |||||
| Complete gene list of ICESt3 from AJ586568 | |||||
| # | Gene | Coordinates [+/-], size (bp) | Product (GenBank annotation) | *Reannotation | |
| 1 | - | 565..1356 [-], 792 | hypothetical protein | ||
| 2 | - | 1520..3192 [+], 1673 | - | ||
| 3 | - | 4092..4466 [+], 375 | hypothetical protein | ||
| 4 | - | 4483..4785 [+], 303 | hypothetical protein | ||
| 5 | - | 5079..6176 [+], 1098 | putative cytosine-specific methyltransferase | ||
| 6 | - | 6163..7389 [+], 1227 | putative cytosine-specific methyltransferase | ||
| 7 | - | 7414..8457 [-], 1044 | hypothetical protein | ||
| 8 | - | 8650..9390 [-], 741 | hypothetical protein | ||
| 9 | - | 9659..10447 [-], 789 | - | ||
| 10 | - | 10478..10792 [-], 315 | - | ||
| 11 | arp1 | 10981..11667 [-], 687 | putative transcriptional regulator | ||
| 12 | - | 11676..12479 [-], 804 | putative transcriptional regulator | ||
| 13 | - | 12795..12989 [-], 195 | putative transmembrane protein | ||
| 14 | - | 13029..13217 [-], 189 | putative transcriptional regulator | ||
| 15 | arp2 | 13223..13564 [-], 342 | putative transcriptional regulator | ||
| 16 | - | 14427..14723 [+], 297 | putative transfer protein | OrfM; conjugative transfer; [PMID: 15073287] | |
| 17 | - | 14745..15206 [+], 462 | putative transfer protein | OrfL; conjugative transfer; [PMID: 15073287] | |
| 18 | - | 15220..16908 [+], 1689 | putative transfer protein | YdcQ, T4SS component | |
| 19 | - | 17116..18348 [+], 1233 | putative transfer protein | Relaxase, MOBT Family | |
| 20 | - | 18363..18593 [+], 231 | hypothetical protein | ||
| 21 | - | 18597..19154 [+], 558 | putative transfer protein | OrfH; conjugative transfer; [PMID: 15073287] | |
| 22 | - | 19166..20161 [+], 996 | putative transfer protein | OrfG; conjugative transfer; [PMID: 15073287] | |
| 23 | - | 20171..20395 [+], 225 | putative transfer protein | OrfF; conjugative transfer; [PMID: 15073287] | |
| 24 | - | 20398..20808 [+], 411 | putative transfer protein | YddD, T4SS component | |
| 25 | - | 20822..23326 [+], 2505 | putative transfer protein | YddE, T4SS component | |
| 26 | - | 23338..25218 [+], 1881 | putative transfer protein | YddG, T4SS component | |
| 27 | - | 25220..25444 [+], 225 | hypothetical protein | ||
| 28 | - | 25470..26582 [+], 1113 | putative transfer protein | Orf13_p, T4SS component | |
| 29 | xis | 26596..26844 [+], 249 | excisionase | Xis; excisionase; [PMID: 15073287] | |
| 30 | int | 26844..28190 [+], 1347 | tyrosine integrase | Integrase | |
| 31 | fda | 28274..28369 [-], 96 | putative fructose-1,6-diphosphate aldolase | ||
 Flanking regions |
|
(1) Carraro N; Libante V; Morel C; Decaris B; Charron-Bourgoin F; Leblond P; Guedon G (2011). Differential regulation of two closely related integrative and conjugative elements from Streptococcus thermophilus. BMC Microbiol. 0.623611111. [PubMed:22024428]
|
|
(2) Bellanger X; Morel C; Gonot F; Puymege A; Decaris B; Guedon G (2011). Site-specific accretion of an integrative conjugative element together with a related genomic island leads to cis mobilization and gene capture. Mol Microbiol. 81(4):912-25. [PubMed:21722203]
|
|
(3) Bellanger X; Roberts AP; Morel C; Choulet F; Pavlovic G; Mullany P; Decaris B; Guedon G (2009). Conjugative transfer of the integrative conjugative elements ICESt1 and ICESt3 from Streptococcus thermophilus. J Bacteriol. 191(8):2764-75. [PubMed:19181800]
|
|
(4) Bellanger X; Morel C; Decaris B; Guedon G (2008). Regulation of excision of integrative and potentially conjugative elements from Streptococcus thermophilus: role of the arp1 repressor. J Mol Microbiol Biotechnol. 14(1-3):16-21. [PubMed:17957106]
|
|
(5) Bellanger X; Morel C; Decaris B; Guedon G (2007). Derepression of excision of integrative and potentially conjugative elements from Streptococcus thermophilus by DNA damage response: implication of a cI-related repressor. J Bacteriol. 189(4):1478-81. [PubMed:17114247]
|
|
(6) Pavlovic G; Burrus V; Gintz B; Decaris B; Guedon G (2004). Evolution of genomic islands by deletion and tandem accretion by site-specific recombination: ICESt1-related elements from Streptococcus thermophilus. Microbiology. 150(Pt 4):759-74. [PubMed:15073287]
|
| experimental literature |