 oriTDB accession number | 200003 |
| Name | oriT_ICESt3  |
Sequence Completeness  | intact |
| oriT length | 213 nt |
| oriT sequence | GCCTGACCACAGGTCAGGCGCAGACCGTAGCCCGAAGTTCCTAGGCCATGATGAGACTTC AACCCCCGATTTCTAATAGGGGGGTTACATTTGGCCAAAGTGCCACGTCCACCCCTCCTC ATTCCTTGTGGGAGTTGGGATTTCAAGATTTAGAAAGTGTGTCACTTTGGTCCAAAAAGT GTGTCACTTAGTCAAAAGGAGGTGTTCCCATGA |
| IR (inverted repeat) | [1-8] [12-19] nt (GCCTGACC..GGTCAGGC) [61-67] [80-86] nt ( AACCCCC..GGGGGTT) [154-159] [163-168] nt ( AAAGTG..CACTTT) [177-181] [185-189] nt ( AAGTG..CACTT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site | _ |
| Note | _ |
Visualization of oriT structure Reference| [1] Pavlovic G et al (2004) Evolution of genomic islands by deletion and tandem accretion by site-specific recombination: ICESt1-related elements from Streptococcus thermophilus. Microbiology. 150(Pt 4):759-74. [PMID:15073287] |
| ID | 8 |
| Element type | ICE (Conjugative transposon) |
| ICE description | ICESt3 |
| ICEberg accesion number | 79 |
| GenBank accession number | AJ586568.1 |
| Family | ICESt1 |
| Genome size | 28372 bp |
| Coordinate of oriT [+/-] | 16903..17115 [+] |
| Drug resistance | _ |
| Heavy-metal resistance | _ |
| Virulence factor | _ |
| Xenobiotic degradation | _ |
| Host bacterium [NCBI Taxonomy ID] | Streptococcus thermophilus CNRZ385 [1308] |
Reference| [1] Pavlovic G et al (2004) Evolution of genomic islands by deletion and tandem accretion by site-specific recombination: ICESt1-related elements from Streptococcus thermophilus. Microbiology. 150(Pt 4):759-74. [PMID:15073287] |