ICEberg
I. Information of ICE
ICEberg ID45
Name Tn916 This ICE is derived from experimental literature
ICEO ID ICEO_0000358
OrganismEnterococcus faecalis DS16
Size (bp)18032
GC content [Genome] (%)38.75
Insertion siteAT rich regions
FunctionTetracycline resistance
Species that ICE can be transferred toEnterococcus faecalis; Butyrivibrio proteoclasticus; Streptococcus spp.; Lactococcus lactis; Lactobacillus paracasei; Neisseria sp.; Escherichia coli; Desulfitobacterium dehalogenans; Bacillus subtilis; Bacillus thuringiensis subsp. Israelensis
Nucleotide SequenceU09422 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..18032 
Putative oriT region coordinates: 2501..2633;   oriTDB id:  200001
ACTTAACCCCCCGTATCTAACAGGGGGGTACAAATCGACAGGAAACAGTCAAAAAAACATTAGAAAATCC
TTTGGTTACAAGGGATTTACAAAATTTCAGCGTATGTCAAATGGGCTTTAAAAGTTGACATAC
Putative relaxase coordinates: 2861..3850; Gene: orf20 (tecH);  Family:  MOBT


II. ICE interaction with IME/CIME/

The Interaction Network among ICE/IME/CIME


Detailed Informatioin of the Interaction Network
# ICE  Inter_Ele [Type] Methods Donors Recipients Exper_Ref 
1Tn916 IME_GB00957_oriT [IME] insolicoin trans - - -
2Tn916 MTnSag1 [tISSag10] [IME] experimentalin trans Streptococcus agalactiae UCN36 Streptococcus agalactiae BM134; Streptococcus agalactiae BM132 17416666
3Tn916 tISCpe8  [IME] experimentalin trans Clostridium perfringens JIR4225 Clostridium perfringens JIR4394 19684139

experimental This is an interactioin derived from experimental literature
insolico This is a putative interactioin



The graph information of Tn916 components from U09422
Complete gene list of Tn916 from U09422
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)
*Reannotation 
1orf24 (tecL)194..313 [+], 120-TecL; conjugation; [PMID: 28369623
2orf23 (tecK)336..650 [+], 315-TecK; replisome; [PMID: 27698087
3orf22 (tecJ)666..1052 [+], 387-TecJ; replisome; [PMID: 27698087
4orf21 (tecI)1081..2466 [+], 1386-Orf21_Tn, T4SS component 
5orf20 (tecH)2861..3850 [+], 990-Relaxase, MOBT Family
6orf19 (tecG)3893..4114 [+], 222-Orf19_Tn, T4SS component 
7orf18 (ardA)4231..4728 [+], 498-ArdA; sequesters the recipient's type I restriction/modification enzymes; [PMID: 18838147
8orf17 (tecE)4703..5209 [+], 507-Orf17_Tn, T4SS component 
9orf16 (tecD)5193..7640 [+], 2448-Orf16_Tn, T4SS component 
10orf15 (tecC)7643..9907 [+], 2265-Orf15_Tn, T4SS component 
11orf14 (tecB)9816..10817 [+], 1002-Orf14_Tn, T4SS component 
12orf13 (tecA)10814..11746 [+], 933-Orf13_Tn, T4SS component 
13orf1212021..12107 [+], 87tet(M) leader peptide
14tet(M)12123..14042 [+], 1920-AR 
15orf614140..14328 [+], 189-
16orf914388..14741 [-], 354-
17orf1014946..15017 [+], 72-
18orf715195..15668 [+], 474-
19orf815665..15895 [+], 231-
20orf516121..16372 [-], 252-
21Xis-Tn16356..16559 [+], 204-
22Int-Tn16641..17858 [+], 1218-
23Int-Tn16773..17858 [+], 1086-
24Int-Tn16884..17858 [+], 975-Integrase 
 
integrase Gene may contribute to site-specific recombination

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins24Fasta
(1) Cookson AL; Noel S; Hussein H; Perry R; Sang C; Moon CD; Leahy SC; Altermann E; Kelly WJ; Attwood GT (2011). Transposition of Tn916 in the four replicons of the Butyrivibrio proteoclasticus B316(T) genome. FEMS Microbiol Lett. 316(2):144-51. [PubMed:21204937] experimental
(2) Haenni M; Saras E; Bertin S; Leblond P; Madec JY; Payot S (2010). Diversity and mobility of integrative and conjugative elements in bovine isolates of Streptococcus agalactiae, S. dysgalactiae subsp. dysgalactiae, and S. uberis. Appl Environ Microbiol. 76(24):7957-65. [PubMed:20952646] experimental
(3) Hannan S; Ready D; Jasni AS; Rogers M; Pratten J; Roberts AP (2010). Transfer of antibiotic resistance by transformation with eDNA within oral biofilms. FEMS Immunol Med Microbiol. 59(3):345-9. [PubMed:20337719] experimental
(4) Boguslawska J; Zycka-Krzesinska J; Wilcks A; Bardowski J (2009). Intra- and interspecies conjugal transfer of Tn916-like elements from Lactococcus lactis in vitro and in vivo. Appl Environ Microbiol. 75(19):6352-60. [PubMed:19666731] experimental
(5) Devirgiliis C; Coppola D; Barile S; Colonna B; Perozzi G (2009). Characterization of the Tn916 conjugative transposon in a food-borne strain of Lactobacillus paracasei. Appl Environ Microbiol. 75(12):3866-71. [PubMed:19395574] experimental
(6) Serfiotis-Mitsa D; Roberts GA; Cooper LP; White JH; Nutley M; Cooper A; Blakely GW; Dryden DT (2008). The Orf18 gene product from conjugative transposon Tn916 is an ArdA antirestriction protein that inhibits type I DNA restriction-modification systems. J Mol Biol. 383(5):970-81. [PubMed:18838147] experimental
(7) Ye C; Bai X; Zhang J; Jing H; Zheng H; Du H; Cui Z; Zhang S; Jin D; Xu Y; Xiong Y; Zhao A; Luo X; Sun Q; Gottschalk M; Xu J (2008). Spread of Streptococcus suis sequence type 7, China. Emerg Infect Dis. 14(5):787-91. [PubMed:18439362] experimental
(8) Florez AB; Ammor MS; Mayo B (2008). Identification of tet(M) in two Lactococcus lactis strains isolated from a Spanish traditional starter-free cheese made of raw milk and conjugative transfer of tetracycline resistance to lactococci and enterococci. Int J Food Microbiol. 121(2):189-94. [PubMed:18068255] experimental
(9) Rossi-Fedele G; Roberts AP (2007). A preliminary study investigating the survival of tetracycline resistant Enterococcus faecalis after root canal irrigation with high concentrations of tetracycline. Int Endod J. 40(10):772-7. [PubMed:17697106] experimental
(10) Rice LB; Carias LL; Hutton-Thomas R; Rudin S (2007). Interaction of related Tn916-like transposons: analysis of excision events promoted by Tn916 and Tn5386 integrases. J Bacteriol. 189(10):3909-17. [PubMed:17322310] experimental
(11) Rossi-Fedele G; Scott W; Spratt D; Gulabivala K; Roberts AP (2006). Incidence and behaviour of Tn916-like elements within tetracycline-resistant bacteria isolated from root canals. Oral Microbiol Immunol. 21(4):218-22. [PubMed:16842505] experimental
(12) Rocco JM; Churchward G (2006). The integrase of the conjugative transposon Tn916 directs strand- and sequence-specific cleavage of the origin of conjugal transfer, oriT, by the endonuclease Orf20. J Bacteriol. 188(6):2207-13. [PubMed:16513750] experimental
(13) Abbani M; Iwahara M; Clubb RT (2005). The structure of the excisionase (Xis) protein from conjugative transposon Tn916 provides insights into the regulation of heterobivalent tyrosine recombinases. J Mol Biol. 347(1):11-25. [PubMed:15733914] experimental
(14) Hussain HA; Roberts AP; Mullany P (2005). Generation of an erythromycin-sensitive derivative of Clostridium difficile strain 630 (630Deltaerm) and demonstration that the conjugative transposon Tn916DeltaE enters the genome of this strain at multiple sites. J Med Microbiol. 54(Pt 2):137-41. [PubMed:15673506] experimental
(15) Gorfe AA; Caflisch A; Jelesarov I (2004). The role of flexibility and hydration on the sequence-specific DNA recognition by the Tn916 integrase protein: a molecular dynamics analysis. J Mol Recognit. 17(2):120-31. [PubMed:15027032] experimental
(16) Huys G; D'Haene K; Collard JM; Swings J (2004). Prevalence and molecular characterization of tetracycline resistance in Enterococcus isolates from food. Appl Environ Microbiol. 70(3):1555-62. [PubMed:15006778] experimental
(17) Bahl MI; Sorensen SJ; Hansen LH; Licht TR (2004). Effect of tetracycline on transfer and establishment of the tetracycline-inducible conjugative transposon Tn916 in the guts of gnotobiotic rats. Appl Environ Microbiol. 70(2):758-64. [PubMed:14766552] experimental
(18) Roberts AP; Hennequin C; Elmore M; Collignon A; Karjalainen T; Minton N; Mullany P (2003). Development of an integrative vector for the expression of antisense RNA in Clostridium difficile. J Microbiol Methods. 55(3):617-24. [PubMed:14607405] experimental
(19) Taraskina AE; Savicheva AM; Akopian TA; Soroka AE; Momynaliev KT; Govorun VM (2002). Drift of tetM determinant in urogenital microbiocenosis containing mycoplasmas during treatment with a tetracycline antibiotic. Bull Exp Biol Med. 134(1):60-3. [PubMed:12459871] experimental
(20) Connolly KM; Iwahara M; Clubb RT (2002). Xis protein binding to the left arm stimulates excision of conjugative transposon Tn916. J Bacteriol. 184(8):2088-99. [PubMed:11914339] experimental
(21) Hinerfeld D; Churchward G (2001). Xis protein of the conjugative transposon Tn916 plays dual opposing roles in transposon excision. Mol Microbiol. 41(6):1459-67. [PubMed:11580848] experimental
(22) Hinerfeld D; Churchward G (2001). Specific binding of integrase to the origin of transfer (oriT) of the conjugative transposon Tn916. J Bacteriol. 183(9):2947-51. [PubMed:11292817] experimental
(23) Wang H; Roberts AP; Mullany P (2000). DNA sequence of the insertional hot spot of Tn916 in the Clostridium difficile genome and discovery of a Tn916-like element in an environmental isolate integrated in the same hot spot. FEMS Microbiol Lett. 192(1):15-20. [PubMed:11040422] experimental
(24) Pethel B; Churchward G (2000). Coupling sequences flanking Tn916 do not determine the affinity of binding of integrase to the transposon ends and adjacent bacterial DNA. Plasmid. 43(2):123-9. [PubMed:10686130] experimental
(25) Smidt H; Song D; van Der Oost J; de Vos WM (1999). Random transposition by Tn916 in Desulfitobacterium dehalogenans allows for isolation and characterization of halorespiration-deficient mutants. J Bacteriol. 181(22):6882-8. [PubMed:10559152] experimental
(26) Jia Y; Churchward G (1999). Interactions of the integrase protein of the conjugative transposon Tn916 with its specific DNA binding sites. J Bacteriol. 181(19):6114-23. [PubMed:10498726] experimental
(27) Waters VL (1999). Conjugative transfer in the dissemination of beta-lactam and aminoglycoside resistance. Front Biosci. 4:D433-56. [PubMed:10228095] experimental
(28) Marra D; Smith JG; Scott JR (1999). Excision of the conjugative transposon Tn916 in Lactococcus lactis. Appl Environ Microbiol. 65(5):2230-1. [PubMed:10224024] experimental
(29) O'Keeffe T; Hill C; Ross RP (1999). In situ inversion of the conjugative transposon Tn916 in Enterococcus faecium DPC3675. FEMS Microbiol Lett. 173(1):265-71. [PubMed:10220904] experimental
(30) Wojciak JM; Connolly KM; Clubb RT (1999). NMR structure of the Tn916 integrase-DNA complex. Nat Struct Biol. 6(4):366-73. [PubMed:10201406] experimental
(31) Marra D; Scott JR (1999). Regulation of excision of the conjugative transposon Tn916. Mol Microbiol. 31(2):609-21. [PubMed:10027977] experimental
(32) Nelson KE; Richardson DL; Dougherty BA (1997). Tn916 transposition in Haemophilus influenzae Rd: preferential insertion into noncoding DNA. Microb Comp Genomics. 2(4):313-21. [PubMed:9689229] experimental
(33) Connolly KM; Wojciak JM; Clubb RT (1998). Site-specific DNA binding using a variation of the double stranded RNA binding motif. Nat Struct Biol. 5(7):546-50. [PubMed:9665166] experimental
(34) Celli J; Trieu-Cuot P (1998). Circularization of Tn916 is required for expression of the transposon-encoded transfer functions: characterization of long tetracycline-inducible transcripts reading through the attachment site. Mol Microbiol. 28(1):103-17. [PubMed:9593300] experimental
(35) Manganelli R; Ricci S; Pozzi G (1997). The joint of Tn916 circular intermediates is a homoduplex in Enterococcus faecalis. Plasmid. 38(2):71-8. [PubMed:9339464] experimental
(36) Rudy C; Taylor KL; Hinerfeld D; Scott JR; Churchward G (1997). Excision of a conjugative transposon in vitro by the Int and Xis proteins of Tn916. Nucleic Acids Res. 25(20):4061-6. [PubMed:9321658] experimental
(37) Celli J; Poyart C; Trieu-Cuot P (1997). Use of an excision reporter plasmid to study the intracellular mobility of the conjugative transposon Tn916 in gram-positive bacteria. Microbiology. 143 ( Pt 4):1253-61. [PubMed:9141688] experimental
(38) Rudy CK; Scott JR; Churchward G (1997). DNA binding by the Xis protein of the conjugative transposon Tn916. J Bacteriol. 179(8):2567-72. [PubMed:9098054] experimental
(39) Taylor KL; Churchward G (1997). Specific DNA cleavage mediated by the integrase of conjugative transposon Tn916. J Bacteriol. 179(4):1117-25. [PubMed:9023193] experimental
(40) Jaworski DD; Flannagan SE; Clewell DB (1996). Analyses of traA, int-Tn, and xis-Tn mutations in the conjugative transposon Tn916 in Enterococcus faecalis. Plasmid. 36(3):201-8. [PubMed:9007015] experimental
(41) Manganelli R; Ricci S; Pozzi G (1996). Conjugative transposon Tn916: evidence for excision with formation of 5'-protruding termini. J Bacteriol. 178(19):5813-6. [PubMed:8824634] experimental
(42) Showsh SA; Andrews RE Jr (1996). Functional comparison of conjugative transposons Tn916 and Tn925. Plasmid. 35(3):164-73. [PubMed:8812783] experimental
(43) Clewell DB; Jaworski DD; Flannagan SE; Zitzow LA; Su YA (1995). The conjugative transposon Tn916 of Enterococcus faecalis: structural analysis and some key factors involved in movement. Dev Biol Stand. 85:11-7. [PubMed:8586160] experimental
(44) Su YA; Clewell DB (1993). Characterization of the left 4 kb of conjugative transposon Tn916: determinants involved in excision. Plasmid. 30(3):234-50. [PubMed:8302931] experimental
(45) Jaworski DD; Clewell DB (1994). Evidence that coupling sequences play a frequency-determining role in conjugative transposition of Tn916 in Enterococcus faecalis. J Bacteriol. 176(11):3328-35. [PubMed:8195088] experimental
(46) Lu F; Churchward G (1994). Conjugative transposition: Tn916 integrase contains two independent DNA binding domains that recognize different DNA sequences. EMBO J. 13(7):1541-8. [PubMed:8156992] experimental
(47) Flannagan SE; Zitzow LA; Su YA; Clewell DB (1994). Nucleotide sequence of the 18-kb conjugative transposon Tn916 from Enterococcus faecalis. Plasmid. 32(3):350-4. [PubMed:7899523] experimental
(48) Lu F; Churchward G (1995). Tn916 target DNA sequences bind the C-terminal domain of integrase protein with different affinities that correlate with transposon insertion frequency. J Bacteriol. 177(8):1938-46. [PubMed:7721684] experimental
(49) Jaworski DD; Clewell DB (1995). A functional origin of transfer (oriT) on the conjugative transposon Tn916. J Bacteriol. 177(22):6644-51. [PubMed:7592445] experimental
(50) Manganelli R; Romano L; Ricci S; Zazzi M; Pozzi G (1995). Dosage of Tn916 circular intermediates in Enterococcus faecalis. Plasmid. 34(1):48-57. [PubMed:7480170] experimental
(51) Hartley DL; Jones KR; Tobian JA; LeBlanc DJ; Macrina FL (1984). Disseminated tetracycline resistance in oral streptococci: implication of a conjugative transposon. Infect Immun. 45(1):13-7. [PubMed:6329954] experimental
(52) Franke AE; Clewell DB (1981). Evidence for a chromosome-borne resistance transposon (Tn916) in Streptococcus faecalis that is capable of "conjugal" transfer in the absence of a conjugative plasmid. J Bacteriol. 145(1):494-502. [PubMed:6257641] experimental
(53) Scott JR; Kirchman PA; Caparon MG (1988). An intermediate in transposition of the conjugative transposon Tn916. Proc Natl Acad Sci U S A. 85(13):4809-13. [PubMed:2838847] experimental
(54) Clewell DB; Flannagan SE; Ike Y; Jones JM; Gawron-Burke C (1988). Sequence analysis of termini of conjugative transposon Tn916. J Bacteriol. 170(7):3046-52. [PubMed:2838457] experimental
(55) Senghas E; Jones JM; Yamamoto M; Gawron-Burke C; Clewell DB (1988). Genetic organization of the bacterial conjugative transposon Tn916. J Bacteriol. 170(1):245-9. [PubMed:2826394] experimental
(56) Caparon MG; Scott JR (1989). Excision and insertion of the conjugative transposon Tn916 involves a novel recombination mechanism. Cell. 59(6):1027-34. [PubMed:2557157] experimental
(57) Kathariou S; Stephens DS; Spellman P; Morse SA (1990). Transposition of Tn916 to different sites in the chromosome of Neisseria meningitidis: a genetic tool for meningococcal mutagenesis. Mol Microbiol. 4(5):729-35. [PubMed:2167422] experimental
(58) Bertram J; Stratz M; Durre P (1991). Natural transfer of conjugative transposon Tn916 between gram-positive and gram-negative bacteria. J Bacteriol. 173(2):443-8. [PubMed:1846142] experimental
(59) Norgren M; Scott JR (1991). The presence of conjugative transposon Tn916 in the recipient strain does not impede transfer of a second copy of the element. J Bacteriol. 173(1):319-24. [PubMed:1846138] experimental
(60) Flannagan SE; Clewell DB (1991). Conjugative transfer of Tn916 in Enterococcus faecalis: trans activation of homologous transposons. J Bacteriol. 173(22):7136-41. [PubMed:1657880] experimental
(61) Stephens DS; Swartley JS; Kathariou S; Morse SA (1991). Insertion of Tn916 in Neisseria meningitidis resulting in loss of group B capsular polysaccharide. Infect Immun. 59(11):4097-102. [PubMed:1657783] experimental
(62) Storrs MJ; Poyart-Salmeron C; Trieu-Cuot P; Courvalin P (1991). Conjugative transposition of Tn916 requires the excisive and integrative activities of the transposon-encoded integrase. J Bacteriol. 173(14):4347-52. [PubMed:1648556] experimental
(63) Mullany P; Wilks M; Tabaqchali S (1991). Transfer of Tn916 and Tn916 delta E into Clostridium difficile: demonstration of a hot-spot for these elements in the C. difficile genome. FEMS Microbiol Lett. 63(2-3):191-4. [PubMed:1647998] experimental
(64) Su YA; He P; Clewell DB (1992). Characterization of the tet(M) determinant of Tn916: evidence for regulation by transcription attenuation. Antimicrob Agents Chemother. 36(4):769-78. [PubMed:1323953] experimental
 
experimental experimental literature