AAGCGGAAGTCGCAGGTGTGGACTGATCTTGCTGGCTGGTGTGGCAATAGCCACGCCAGC
ACTTAACCCCCCGTATCTAACAGGGGGGTACAAATCGACAGGAAACAGTCAAAAAAACAT
TAGAAAATCCTTTGGTTACAAGGGATTTACAAAATTTCAGCGTATGTCAAATGGGCTTTA
AAAGTTGACATACGGCCTTTTTGATTGGAGGGATTT
[1] Rocco JM et al (2006) The integrase of the conjugative transposon Tn916 directs strand- and sequence-specific cleavage of the origin of conjugal transfer, oriT, by the endonuclease Orf20. J Bacteriol. 188(6):2207-13. [PMID:16513750] |
[2] Jaworski DD et al (1995) A functional origin of transfer (oriT) on the conjugative transposon Tn916. J Bacteriol. 177(22):6644-51. [PMID:7592445] |
[3] Roberts AP et al (2001) Comparison of Tn5397 from Clostridium difficile, Tn916 from Enterococcus faecalis and the CW459tet(M) element from Clostridium perfringens shows that they have similar conjugation regions but different insertion and excision modules. Microbiology. 147(Pt 5):1243-51. [PMID:11320127] |
[4] Roberts AP et al (2009) A modular master on the move: the Tn916 family of mobile genetic elements. Trends Microbiol. 17(6):251-8. [PMID:19464182] |