ICEberg
I. Information of ICE
ICEberg ID44
Name SXT(MO10) This ICE is derived from experimental literature
ICEO ID ICEO_0000017
OrganismVibrio cholerae O139 MO10
Size (bp)99483
GC content [Genome] (%)47.05
Insertion siteprfC
FunctionResistance to the antibiotics sulfamethoxazole, trimethoprim, chloramphenicol, and streptomycin; Toxin-Antitoxin System
Species that ICE can be transferred toVibrio cholerae; Escherichia coli; Salmonella enterica serovar Typhimurium
Nucleotide SequenceAY055428 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..99483 
Putative oriT region coordinates: 3692..3798;   oriTDB id:  200056
TATCGAGACGCCAAACAGTGATTGTTACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGA
TAGTGGTTTTGGCTTTTGGGGTTAATTGGATGGGGAA
Putative relaxase coordinates: 45176..47326; Gene: traI;  Family:  MOBH


II. ICE interaction with IME/CIME/

The Interaction Network among ICE/IME/CIME


Detailed Informatioin of the Interaction Network
# ICE  Inter_Ele [Type] Methods Donors Recipients Exper_Ref 
1SXT(MO10) MGIVchUSA1 [IME] experimentalin trans E. coli CAG18420 E. coli VB112 20807202
2SXT(MO10) MGIVflInd1 [IME] experimentalin trans E. coli AD64 E. coli CAG18439 20807202
3SXT(MO10) MGIVvuTai1 [IME] experimentalin trans E. coli CAG18420 E. coli VB112 20807202

experimental This is an interactioin derived from experimental literature



The graph information of SXT(MO10) components from AY055428
Complete gene list of SXT(MO10) from AY055428
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)		 *Reannotation 
1int833..2074 [-], 1242integraseIntegrase 
2s002 (srpR)2076..2345 [-], 270unknownSrpR; an active partitioning system; [PMID: 26061412] 
3s003 (srpM)2348..3322 [-], 975unknownSrpM; an active partitioning system; [PMID: 26061412] 
4rumB'4241..5413 [-], 1173UV repair DNA polymerase
5tnp5697..6290 [+], 594putative transposase
6tnpA6404..9304 [+], 2901putative transposase
7tnpB9799..11292 [+], 1494putative transposase
8dhfR1811653..12207 [-], 555dhfR18
9s00912221..12766 [-], 546unknown
10s01012766..13932 [-], 1167unknown
11dcd13947..14675 [-], 729deoxycytidine triphosphate deaminase
12'tnpB14935..15267 [+], 333putative transposase
13s01315298..16182 [+], 885unknown
14floR16399..17613 [+], 1215florfenicol exporterAR 
15s01517641..17946 [+], 306unknown
16tnpB'18058..18597 [+], 540putative transposase
17strB18569..19405 [-], 837streptomycin phosphotransferaseAR 
18strA19406..20208 [-], 803streptomycin phosphotransferaseAR 
19sulII20269..21084 [-], 816dihydropteroate synthase type IIAR 
20tnpA'21555..23168 [+], 1614putative transposase
21s02122636..23358 [-], 723unknown
22'rumB23511..23831 [-], 321UV repair DNA polymerase
23rumA23788..24237 [-], 450UV repair
24s02424876..25784 [+], 909unknown
25s02525858..26172 [+], 315unknown
26s02626241..27167 [+], 927unknown
27s02727395..27778 [+], 384unknown
28s02827766..28359 [+], 594unknown
29s02928378..30273 [+], 1896unknown
30s03030325..31923 [+], 1599unknown
31s03132037..32519 [+], 483unknown
32s03232488..33240 [+], 753unknown
33s03333237..33995 [+], 759unknown
34s03433999..34679 [+], 681unknown
35s03534672..35871 [+], 1200unknown
36s03635852..36232 [+], 381unknown
37s03736399..37013 [+], 615unknown
38s03837601..40234 [+], 2634unknown
39s03940251..42326 [+], 2076unknown
40s04042331..45021 [+], 2691unknown
41traI45176..47326 [+], 2151conjugative relaxaseRelaxase, MOBH Family
42traD47396..49195 [+], 1800conjugative coupling factorTraD_F, T4SS component 
43s04349753..50388 [+], 636putative conjugation coupling factor
44s04450414..50692 [-], 279unknownantitoxin, type II toxin-antitoxin system; [PMID: 17158670] 
45s04550689..51012 [-], 324unknowntoxin, type II toxin-antitoxin system; [PMID: 17158670] 
46traL51187..51474 [+], 288sex pilus assemblyTraL_F, T4SS component 
47traE51471..52097 [+], 627sex pilus assemblyTraE_F, T4SS component 
48s048 (traK)52078..52977 [+], 900unknownTraK_F, T4SS component 
49traB52980..54269 [+], 1290sex pilus assemblyTraB_F, T4SS component 
50traV54266..54916 [+], 651sex pilus assemblyTraV_F, T4SS component 
51traA54913..55299 [+], 387putative pilin subunitTraA_F, T4SS component 
52s052 (mosA)55664..56311 [+], 648unknownMosA; antitoxin, type II toxin-antitoxin system; [PMID: 19325886] 
53s053 (mosT)56292..57242 [+], 951unknownMosT; toxin, type II toxin-antitoxin system; [PMID: 19325886] 
54s054 (dsbC)57374..58066 [+], 693putative disulfide bond isomeraseTrbB_I, T4SS component 
55traC58066..60465 [+], 2400sex pilus assemblyTraC_F, T4SS component 
56trsF60789..61301 [+], 513conjugation signal peptidaseTraF, T4SS component 
57traW61216..62436 [+], 1221sex pilus assemblyTraW_F, T4SS component 
58traU62420..63448 [+], 1029sex pilus assemblyTraU_F, T4SS component 
59traN63683..67147 [+], 3465mating pair stabilizationTraN_F, T4SS component 
60s06067924..69006 [-], 1083unknown
61s06169006..70070 [-], 1065unknown
62s06270183..70899 [-], 717unknown
63s06371008..71610 [-], 603unknown
64ssb72318..72737 [+], 420single-stranded DNA binding protein
65s065 (bet)72817..73635 [+], 819putative DNA recombination proteinBet; a &lamda; Red-like homologous recombination system; [PMID: 20019796] 
66s066 (exo)73921..74937 [+], 1017unknownExo; a &lamda; Red-like homologous recombination system; [PMID: 20019796] 
67s06775030..76106 [+], 1077unknown
68s06876975..77928 [+], 954unknown
69s06977990..78430 [+], 441unknown
70s07078500..80155 [+], 1656unknown
71s071 (radC)80237..80734 [+], 498putative DNA repair radCRadC; [PMID: 29654185] 
72s07281243..82244 [+], 1002unknown
73s07382335..83042 [+], 708unknown
74s074 (dgcL)83304..84233 [-], 930putative response regulatorDgcL; [PMID: 19888998] 
75-84239..88045 [-], 3807putative histidine kinase
76traF88747..89724 [+], 978sex pilus assemblyTraF_F, T4SS component 
77traH89727..91115 [+], 1389sex pilus assemblyTraH_F, T4SS component 
78traG91119..94688 [+], 3570sex pilus assemblyTraG_F, T4SS component 
79s079 (eexS)94721..95173 [-], 453unknownEexS; entry exclusion factor; [PMID: 15935784; 29654185] 
80setC95207..95740 [-], 534transcriptional activator
81setD95737..96036 [-], 300transcriptional activator
82s08296033..96581 [-], 549unknownOrf169_F, T4SS component 
83s08396568..96936 [-], 369unknown
84s08496926..97231 [-], 306unknown
85s08597218..97739 [-], 522unknown
86s086 (croS)98144..98395 [-], 252unknownCroS; transcriptional repressors; [PMID: 29654185] 
87setR98513..99160 [+], 648transcriptional repressor
 

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins87Fasta
(1) Daccord A; Mursell M; Poulin-Laprade D; Burrus V (2012). Dynamics of the SetCD-Regulated Integration and Excision of Genomic Islands Mobilized by Integrating Conjugative Elements of the SXT/R391 Family. J Bacteriol. 194(21):5794-802. [PubMed:22923590] experimental
(2) Pande K; Mendiratta DK; Vijayashri D; Thamke DC; Narang P (2012). SXT constin among Vibrio cholerae isolates from a tertiary care hospital. Indian J Med Res. 135:346-50. [PubMed:22561621] experimental
(3) Spagnoletti M; Ceccarelli D; Colombo MM (2012). Rapid detection by multiplex PCR of Genomic Islands, prophages and Integrative Conjugative Elements in V. cholerae 7th pandemic variants. J Microbiol Methods. 88(1):98-102. [PubMed:22062086] experimental
(4) Chen WY; Ho JW; Huang JD; Watt RM (2011). Functional characterization of an alkaline exonuclease and single strand annealing protein from the SXT genetic element of Vibrio cholerae. BMC Mol Biol. 12(1):16. [PubMed:21501469] experimental
(5) Wozniak RA; Fouts DE; Spagnoletti M; Colombo MM; Ceccarelli D; Garriss G; Dery C; Burrus V; Waldor MK (2009). Comparative ICE genomics: insights into the evolution of the SXT/R391 family of ICEs. PLoS Genet. 5(12):e1000786. [PubMed:20041216] in_silico
(6) Bordeleau E; Brouillette E; Robichaud N; Burrus V (2010). Beyond antibiotic resistance: integrating conjugative elements of the SXT/R391 family that encode novel diguanylate cyclases participate to c-di-GMP signalling in Vibrio cholerae. Environ Microbiol. 12(2):510-23. [PubMed:19888998] experimental
(7) Wozniak RA; Waldor MK (2009). A toxin-antitoxin system promotes the maintenance of an integrative conjugative element. PLoS Genet. 5(3):e1000439. [PubMed:19325886] experimental
(8) Ceccarelli D; Daccord A; Rene M; Burrus V (2008). Identification of the origin of transfer (oriT) and a new gene required for mobilization of the SXT/R391 family of integrating conjugative elements. J Bacteriol. 190(15):5328-38. [PubMed:18539733] experimental
(9) Marrero J; Waldor MK (2007). The SXT/R391 family of integrative conjugative elements is composed of two exclusion groups. J Bacteriol. 189(8):3302-5. [PubMed:17307849] experimental
(10) McLeod SM; Burrus V; Waldor MK (2006). Requirement for Vibrio cholerae integration host factor in conjugative DNA transfer. J Bacteriol. 188(16):5704-11. [PubMed:16885438] experimental
(11) Marrero J; Waldor MK (2005). Interactions between inner membrane proteins in donor and recipient cells limit conjugal DNA transfer. Dev Cell. 8(6):963-70. [PubMed:15935784] experimental
(12) Beaber JW; Waldor MK (2004). Identification of operators and promoters that control SXT conjugative transfer. J Bacteriol. 186(17):5945-9. [PubMed:15317801] experimental
(13) Burrus V; Waldor MK (2004). Formation of SXT tandem arrays and SXT-R391 hybrids. J Bacteriol. 186(9):2636-45. [PubMed:15090504] experimental
(14) Boltner D; Osborn AM (2004). Structural comparison of the integrative and conjugative elements R391, pMERPH, R997, and SXT. Plasmid. 51(1):12-23. [PubMed:14711525] experimental
(15) Beaber JW; Hochhut B; Waldor MK (2004). SOS response promotes horizontal dissemination of antibiotic resistance genes. Nature. 427(6969):72-4. [PubMed:14688795] experimental
(16) Burrus V; Waldor MK (2003). Control of SXT integration and excision. J Bacteriol. 185(17):5045-54. [PubMed:12923077] experimental
(17) Thungapathra M; Amita; Sinha KK; Chaudhuri SR; Garg P; Ramamurthy T; Nair GB; Ghosh A (2002). Occurrence of antibiotic resistance gene cassettes aac(6')-Ib, dfrA5, dfrA12, and ereA2 in class I integrons in non-O1, non-O139 Vibrio cholerae strains in India. Antimicrob Agents Chemother. 46(9):2948-55. [PubMed:12183252] experimental
(18) Beaber JW; Hochhut B; Waldor MK (2002). Genomic and functional analyses of SXT, an integrating antibiotic resistance gene transfer element derived from Vibrio cholerae. J Bacteriol. 184(15):4259-69. [PubMed:12107144] experimental
(19) Hochhut B; Lotfi Y; Mazel D; Faruque SM; Woodgate R; Waldor MK (2001). Molecular analysis of antibiotic resistance gene clusters in vibrio cholerae O139 and O1 SXT constins. Antimicrob Agents Chemother. 45(11):2991-3000. [PubMed:11600347] experimental
(20) Hochhut B; Beaber JW; Woodgate R; Waldor MK (2001). Formation of chromosomal tandem arrays of the SXT element and R391, two conjugative chromosomally integrating elements that share an attachment site. J Bacteriol. 183(4):1124-32. [PubMed:11157923] experimental
(21) Hochhut B; Marrero J; Waldor MK (2000). Mobilization of plasmids and chromosomal DNA mediated by the SXT element, a constin found in Vibrio cholerae O139. J Bacteriol. 182(7):2043-7. [PubMed:10715015] experimental
(22) Hochhut B; Waldor MK (1999). Site-specific integration of the conjugal Vibrio cholerae SXT element into prfC. Mol Microbiol. 32(1):99-110. [PubMed:10216863] experimental
(23) Waldor MK; Tschape H; Mekalanos JJ (1996). A new type of conjugative transposon encodes resistance to sulfamethoxazole, trimethoprim, and streptomycin in Vibrio cholerae O139. J Bacteriol. 178(14):4157-65. [PubMed:8763944] experimental
 
experimental experimental literature
in_silico in silico analysis literature

Genomics & Bioinformatics Group in MML, SJTU