ICEberg
I. Information of IME
ICEberg ID181_IME
Name MGIVvuTai1 This IME is derived from experimental literature
Family-
OrganismVibrio vulnificus YJ016
Size (bp)19.0 kb
GC content [Genome] (%)
Insertion site3′ end of yicC
Function-
Species that IME can be transferred to-
Nucleotide SequenceBA000037.2 (complete IME sequence in this genome)
Replicon-
Genome coordinates270097..289135
Putative oriT region coordinates: 285352..285455;   oriTDB id:  200056
ATCGAGAAGCTAAACAGTGAATGGGCTAATTTCCCTGTTTGGCGTTTCGATCCAAAAGCCAAACGGATAG
TGGTTTTGGCGTATGGGGGTAAAGGCATGGGGAA
Putative relaxase -


II. IME interaction with ICE/CIME/Plasmids

The Interaction Network among ICE/IME/CIME/plasmid


Detailed Informatioin of the Interaction Network
# IME  Inter_Ele [Type] Methods Donors Recipients Exper_Ref 
1MGIVvuTai1 SXT(MO10) [ICE] experimentalin trans E. coli CAG18420 E. coli VB112 20807202

experimental This is an interactioin derived from experimental literature


The graph information of MGIVvuTai1 components from BA000037
Complete gene list of MGIVvuTai1 from BA000037
#GeneCoordinates [+/-], size (bp) Product *Reannotation 
1VV0254266185..267054 [+], 870ABC-type oligopeptide transport system, ATPase component
2VV0255266984..267904 [+], 921ABC-type oligopeptide transport system, ATPase component
3VV0256268030..268473 [+], 444conserved hypothetical protein
4VV0257268628..269011 [+], 384hypothetical protein
5VV0258269057..270097 [+], 1041putative membrane protein
6VV0259270073..270300 [+], 228hypothetical protein
7VV0260270370..270498 [+], 129hypothetical protein
8VV0261270633..271952 [-], 1320conserved hypothetical protein
9VV0262272326..272583 [+], 258conserved hypothetical protein
10VV0263272561..274309 [+], 1749conserved hypothetical protein
11VV0264274559..274756 [+], 198VrlI homologue
12VV0265274695..277148 [+], 2454type I site-specific restriction-modification system, R (restriction) subunit
13VV0266277154..278746 [+], 1593type I restriction-modification system methyltransferase subunit
14VV0267278743..279885 [+], 1143type I restriction-modification enzyme, specificity subunit
15VV0268279885..280682 [+], 798hypothetical protein
16VV0269280679..283921 [+], 3243hypothetical protein
17VV0270284319..285020 [-], 702hypothetical protein
18VV0271285144..285329 [-], 186hypothetical protein
19VV0272285448..285567 [+], 120hypothetical protein
20VV0273285564..286616 [+], 1053hypothetical protein
21VV0274286617..287096 [+], 480hypothetical protein
22VV0275287147..287317 [-], 171hypothetical protein
23VV0276287229..287606 [-], 378hypothetical protein
24VV0277287569..288873 [-], 1305site-specific recombinase, phage integrase familyIntegrase 
25VV0278289135..290022 [-], 888uncharacterized stress-induced protein
26VV0279290211..290927 [+], 717RNase PH
27VV0280291084..291725 [+], 642orotate phosphoribosyltransferase
28VV0281291825..292763 [-], 939lipid A biosynthesis lauroyl acyltransferase
29VV0282292767..293357 [-], 591transcriptional regulator
 
flank Flanking regions
integrase Gene may contribute to site-specific recombination

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins18Fasta
(1) Guedon G; Libante V; Coluzzi C; Payot S; Leblond-Bourget N (2017). The Obscure World of Integrative and Mobilizable Elements, Highly Widespread Elements that Pirate Bacterial Conjugative Systems. Genes (Basel). 8(11). [PudMed:29165361]
(2) Bellanger X; Payot S; Leblond-Bourget N; Guedon G (2014). Conjugative and mobilizable genomic islands in bacteria: evolution and diversity. FEMS Microbiol Rev. 38(4):720-60. [PudMed:24372381]
(3) Daccord A; Ceccarelli D; Rodrigue S; Burrus V (2013). Comparative analysis of mobilizable genomic islands. J Bacteriol. 195(3):606-14. [PudMed:23204461] experimental in_silico
(4) Daccord A; Ceccarelli D; Burrus V (2010). Integrating conjugative elements of the SXT/R391 family trigger the excision and drive the mobilization of a new class of Vibrio genomic islands. Mol Microbiol. 78(3):576-88. [PudMed:20807202] experimental
 
experimental experimental literature
in_silico in silico analysis literature

Genomics & Bioinformatics Group in MML, SJTU