CCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAG
TGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGG
[1] Guiney DG et al (1983) Location and nucleotide sequence of the transfer origin of the broad host range plasmid RK2. Proc Natl Acad Sci U S A. 80(12):3595-8. [PMID:6304722] |
[2] Cook DM et al (1992) The oriT region of the Agrobacterium tumefaciens Ti plasmid pTiC58 shares DNA sequence identity with the transfer origins of RSF1010 and RK2/RP4 and with T-region borders. J Bacteriol. 174(19):6238-46. [PMID:1400174] |
[3] Schmidhauser TJ et al (1985) Regions of broad-host-range plasmid RK2 involved in replication and stable maintenance in nine species of gram-negative bacteria. J Bacteriol. 164(1):446-55. [PMID:4044529] |
[4] Dam B et al (2009) Conjugative Type 4 secretion system of a novel large plasmid from the chemoautotroph Tetrathiobacter kashmirensis and construction of shuttle vectors for Alcaligenaceae. Appl Environ Microbiol. 75(13):4362-73. [PMID:19411426] |
[5] Waters VL et al (1991) Sequence identity in the nick regions of IncP plasmid transfer origins and T-DNA borders of Agrobacterium Ti plasmids. Proc Natl Acad Sci U S A. 88(4):1456-60. [PMID:1996345] |