GAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTG
CCCGGCTGACGCCGTTGGATACACCAAGGAAAGTCTACA
[1] Pansegrau W et al (1988) The origin of conjugative IncP plasmid transfer: interaction with plasmid-encoded products and the nucleotide sequence at the relaxation site. Biochim Biophys Acta. 951(2-3):365-74. [PMID:2850014] |
[2] Pansegrau W et al (1993) Relaxase (TraI) of IncP alpha plasmid RP4 catalyzes a site-specific cleaving-joining reaction of single-stranded DNA. Proc Natl Acad Sci U S A. 90(7):2925-9. [PMID:8385350] |
[3] Pansegrau W et al (1990) In vitro assembly of relaxosomes at the transfer origin of plasmid RP4. Proc Natl Acad Sci U S A. 87(17):6555-9. [PMID:2168553] |
[4] Cook DM et al (1992) The oriT region of the Agrobacterium tumefaciens Ti plasmid pTiC58 shares DNA sequence identity with the transfer origins of RSF1010 and RK2/RP4 and with T-region borders. J Bacteriol. 174(19):6238-46. [PMID:1400174] |
[5] Fürste JP et al (1989) Conjugative transfer of promiscuous IncP plasmids: interaction of plasmid-encoded products with the transfer origin. Proc Natl Acad Sci U S A. 86(6):1771-5. [PMID:2538813] |
[6] Dam B et al (2009) Conjugative Type 4 secretion system of a novel large plasmid from the chemoautotroph Tetrathiobacter kashmirensis and construction of shuttle vectors for Alcaligenaceae. Appl Environ Microbiol. 75(13):4362-73. [PMID:19411426] |