Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | shoB-ohsC/- |
| Location | 2700117..2700596 | Replicon | chromosome |
| Accession | NC_000913 | ||
| Organism | Escherichia coli str. K-12 substr. MG1655 | ||
| T1TAdb ID | TA07183 | ||
Toxin (Protein)
| Gene name | shoB | Uniprot ID | C1P611 |
| Locus tag | b4687 | Protein ID | YP_002791251.1 |
| Coordinates | 2700117..2700197 (-) | Length | 27 a.a. |
Antitoxin (RNA)
| Gene name | ohsC | ||
| Locus tag | b4608 | ||
| Coordinates | 2700523..2700599 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| b2558 | 2695801..2697357 | + | 1557 | NP_417053.2 | membrane-bound lytic murein transglycosylase F | - |
| b2559 | 2697354..2697857 | - | 504 | NP_417054.2 | tRNA adenosine(34) deaminase | - |
| b2560 | 2697915..2698550 | - | 636 | NP_417055.4 | phosphatidylglycerophosphatase C | - |
| b2561 | 2698759..2699607 | + | 849 | NP_417056.2 | putative DNA-binding transcriptional regulator YfhH | - |
| b2562 | 2699663..2699923 | + | 261 | NP_417057.1 | putative 4Fe-4S cluster-containing protein YfhL | - |
| b4687 | 2700117..2700197 | - | 81 | YP_002791251.1 | toxic peptide ShoB | Toxin |
| - | 2700523..2700599 | + | 77 | - | - | Antitoxin |
| b2563 | 2700618..2700998 | - | 381 | NP_417058.1 | holo-[acyl-carrier-protein] synthase | - |
| b2564 | 2700998..2701729 | - | 732 | NP_417059.1 | pyridoxine 5'-phosphate synthase | - |
| b2565 | 2701741..2702469 | - | 729 | NP_417060.1 | recombination mediator protein RecO | - |
| b2566 | 2702481..2703386 | - | 906 | NP_417061.1 | 30S ribosomal subunit maturation GTPase Era | - |
| b2567 | 2703383..2704063 | - | 681 | NP_417062.1 | RNase III | - |
| b2568 | 2704335..2705309 | - | 975 | NP_417063.1 | signal peptidase I | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 27 a.a. Molecular weight: 3103.00 Da Isoelectric Point: 10.2378
>T6358 YP_002791251.1 NC_000913:c2700197-2700117 [Escherichia coli str. K-12 substr. MG1655]
MTDCRYLIKRVIKIIIAVLQLILLFL
MTDCRYLIKRVIKIIIAVLQLILLFL
Download Length: 81 bp
>T6358 NC_000913:c2700197-2700117 [Escherichia coli str. K-12 substr. MG1655]
ATGACTGATTGCCGATACCTGATTAAACGGGTCATCAAAATCATCATTGCTGTTTTACAGCTGATCCTTCTGTTCTTATA
A
ATGACTGATTGCCGATACCTGATTAAACGGGTCATCAAAATCATCATTGCTGTTTTACAGCTGATCCTTCTGTTCTTATA
A
Antitoxin
Download Length: 77 bp
>AT6358 NC_000913:2700523-2700599 [Escherichia coli str. K-12 substr. MG1655]
GAGGGTGCATGCTGCACAAAATTAAAGTTAAAAAGTAAAACCCCCGTTCCTTACCAGTTCGGGGGTTTTACTTTTTA
GAGGGTGCATGCTGCACAAAATTAAAGTTAAAAAGTAAAACCCCCGTTCCTTACCAGTTCGGGGGTTTTACTTTTTA
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| T10212 | Escherichia coli str. K-12 substr. W3110 |
100 |
100 |
1 |
Multiple sequence alignment
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
References
(1) Elizabeth M Fozo et al. (2008) Repression of small toxic protein synthesis by the Sib and OhsC small RNAs. Molecular Microbiology 70(5):1076-93. [PubMed:18710431]
(2) Elizabeth M Fozo et al. (2010) Abundance of type I toxin-antitoxin systems in bacteria: searches for new candidates and discovery of novel families. Nucleic Acids Research 38(11):3743-59. [PubMed:20156992]