Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | shoB-ohsC/- |
| Location | 2698773..2699255 | Replicon | chromosome |
| Accession | NC_007779 | ||
| Organism | Escherichia coli str. K-12 substr. W3110 | ||
| T1TAdb ID | TA06333 | ||
Toxin (Protein)
| Gene name | shoB | Uniprot ID | C1P611 |
| Locus tag | Y75_RS13405 | Protein ID | WP_000128776.1 |
| Coordinates | 2698773..2698853 (-) | Length | 27 a.a. |
Antitoxin (RNA)
| Gene name | ohsC | ||
| Locus tag | - | ||
| Coordinates | 2699179..2699255 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| Y75_RS13380 (Y75_p2511) | 2694457..2696013 | + | 1557 | WP_000734212.1 | membrane-bound lytic murein transglycosylase MltF | - |
| Y75_RS13385 (Y75_p2512) | 2696010..2696513 | - | 504 | WP_001297409.1 | tRNA adenosine(34) deaminase TadA | - |
| Y75_RS13390 (Y75_p2513) | 2696571..2697206 | - | 636 | WP_000190655.1 | phosphatidylglycerophosphatase C | - |
| Y75_RS13395 (Y75_p2514) | 2697415..2698263 | + | 849 | WP_001013779.1 | MurR/RpiR family transcriptional regulator | - |
| Y75_RS13400 (Y75_p2515) | 2698319..2698579 | + | 261 | WP_001196283.1 | 4Fe-4S dicluster ferredoxin YfhL | - |
| Y75_RS13405 | 2698773..2698853 | - | 81 | WP_000128776.1 | type I toxin-antitoxin system toxin ShoB | Toxin |
| - | 2699179..2699255 | + | 77 | - | - | Antitoxin |
| Y75_RS13420 (Y75_p2516) | 2699274..2699654 | - | 381 | WP_000986023.1 | holo-ACP synthase | - |
| Y75_RS13425 (Y75_p2517) | 2699654..2700385 | - | 732 | WP_001297412.1 | pyridoxine 5'-phosphate synthase | - |
| Y75_RS13430 (Y75_p2518) | 2700397..2701125 | - | 729 | WP_000399404.1 | DNA repair protein RecO | - |
| Y75_RS13435 (Y75_p2519) | 2701137..2702042 | - | 906 | WP_000020749.1 | GTPase Era | - |
| Y75_RS13440 (Y75_p2520) | 2702039..2702719 | - | 681 | WP_001068343.1 | ribonuclease III | - |
| Y75_RS13445 (Y75_p2521) | 2702991..2703965 | - | 975 | WP_000002541.1 | signal peptidase I | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 27 a.a. Molecular weight: 3103.00 Da Isoelectric Point: 10.2378
>T10212 WP_000128776.1 NC_007779:c2698853-2698773 [Escherichia coli str. K-12 substr. W3110]
MTDCRYLIKRVIKIIIAVLQLILLFL
MTDCRYLIKRVIKIIIAVLQLILLFL
Download Length: 81 bp
>T10212 NC_007779:c2698853-2698773 [Escherichia coli str. K-12 substr. W3110]
ATGACTGATTGCCGATACCTGATTAAACGGGTCATCAAAATCATCATTGCTGTTTTACAGCTGATCCTTCTGTTCTTATA
A
ATGACTGATTGCCGATACCTGATTAAACGGGTCATCAAAATCATCATTGCTGTTTTACAGCTGATCCTTCTGTTCTTATA
A
Antitoxin
Download Length: 77 bp
>AT10212 NC_007779:2699179-2699255 [Escherichia coli str. K-12 substr. W3110]
GAGGGTGCATGCTGCACAAAATTAAAGTTAAAAAGTAAAACCCCCGTTCCTTACCAGTTCGGGGGTTTTACTTTTTA
GAGGGTGCATGCTGCACAAAATTAAAGTTAAAAAGTAAAACCCCCGTTCCTTACCAGTTCGGGGGTTTTACTTTTTA
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| T6358 | Escherichia coli str. K-12 substr. MG1655 |
100 |
100 |
1 |
Multiple sequence alignment
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
References
(1) Elizabeth M Fozo et al. (2010) Abundance of type I toxin-antitoxin systems in bacteria: searches for new candidates and discovery of novel families. Nucleic Acids Research 38(11):3743-59. [PubMed:20156992]