Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | tisB-istR/- |
| Location | 3853118..3853642 | Replicon | chromosome |
| Accession | NC_000913 | ||
| Organism | Escherichia coli str. K-12 substr. MG1655 | ||
| T1TAdb ID | TA07186 | ||
Toxin (Protein)
| Gene name | tisB | Uniprot ID | A5A627 |
| Locus tag | b4618 | Protein ID | YP_001165331.1 |
| Coordinates | 3853553..3853642 (+) | Length | 30 a.a. |
Antitoxin (RNA)
| Gene name | istR | ||
| Locus tag | b4616 | ||
| Coordinates | 3853115..3853198 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| b3668 | 3848634..3850136 | - | 1503 | NP_418124.4 | sensory histidine kinase UhpB | - |
| b3669 | 3850136..3850726 | - | 591 | NP_418125.1 | DNA-binding transcriptional activator UhpA | - |
| b3670 | 3850802..3851092 | - | 291 | NP_418126.1 | acetohydroxy acid synthase I subunit IlvN | - |
| b3671 | 3851096..3852784 | - | 1689 | NP_418127.1 | acetohydroxy acid synthase I subunit IlvB | - |
| b3672 | 3852890..3852988 | - | 99 | NP_418128.1 | ilvBN operon leader peptide | - |
| - | 3853115..3853198 | - | 84 | - | - | Antitoxin |
| b4618 | 3853553..3853642 | + | 90 | YP_001165331.1 | membrane-depolarizing toxin TisB | Toxin |
| b4798 | 3853766..3853840 | - | 75 | YP_010051212.1 | protein YsdE | - |
| b3673 | 3853922..3855106 | + | 1185 | NP_418129.2 | multidrug efflux pump EmrD | - |
| b3674 | 3855114..3855611 | - | 498 | NP_418130.1 | uncharacterized protein YidF | - |
| b3675 | 3855608..3855970 | - | 363 | NP_418131.1 | inner membrane protein YidG | - |
| b3676 | 3855960..3856307 | - | 348 | NP_418132.1 | DUF202 domain-containing inner membrane protein YidH | - |
| b3677 | 3856415..3856864 | + | 450 | NP_418133.1 | putative inner membrane protein YidI | - |
| b3678 | 3856911..3858404 | - | 1494 | NP_418134.1 | putative sulfatase/phosphatase YidJ | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 30 a.a. Molecular weight: 3222.10 Da Isoelectric Point: 8.6905
>T6350 YP_001165331.1 NC_000913:3853553-3853642 [Escherichia coli str. K-12 substr. MG1655]
MNLVDIAILILKLIVAALQLLDAVLKYLK
MNLVDIAILILKLIVAALQLLDAVLKYLK
Download Length: 90 bp
>T6350 NC_000913:3853553-3853642 [Escherichia coli str. K-12 substr. MG1655]
ATGAACCTGGTGGATATCGCCATTCTTATCCTCAAACTCATTGTTGCAGCACTGCAACTGCTTGATGCTGTTCTGAAATA
CCTGAAGTAA
ATGAACCTGGTGGATATCGCCATTCTTATCCTCAAACTCATTGTTGCAGCACTGCAACTGCTTGATGCTGTTCTGAAATA
CCTGAAGTAA
Antitoxin
Download Length: 84 bp
>AT6350 NC_000913:c3853198-3853115 [Escherichia coli str. K-12 substr. MG1655]
TTCAGTGTTGACATAATACAGTGTGCTTTGCGGTTACCAGCCGCAGGCGACTGACGAAACCTCGCTCCGGCGGGGTTTTT
TGTT
TTCAGTGTTGACATAATACAGTGTGCTTTGCGGTTACCAGCCGCAGGCGACTGACGAAACCTCGCTCCGGCGGGGTTTTT
TGTT
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| T6349 | Escherichia coli BW2952 |
100 |
100 |
1 |
Multiple sequence alignment
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
References
(1) Elizabeth M Fozo et al. (2010) Abundance of type I toxin-antitoxin systems in bacteria: searches for new candidates and discovery of novel families. Nucleic Acids Research 38(11):3743-59. [PubMed:20156992]
(2) Tiffany M Halvorsen et al. (2022) Comparison of Kill Switch Toxins in Plant-Beneficial Pseudomonas fluorescens Reveals Drivers of Lethality, Stability, and Escape. ACS Synthetic Biology 11(11):3785-3796. [PubMed:36346907]
(3) Jörg Vogel et al. (2004) The small RNA IstR inhibits synthesis of an SOS-induced toxic peptide. Current Biology : CB 14(24):2271-6. [PubMed:15620655]
(4) Daniel Edelmann et al. (2021) Elevated Expression of Toxin TisB Protects Persister Cells against Ciprofloxacin but Enhances Susceptibility to Mitomycin C. Microorganisms 9(5):943. [PubMed:33925723]
(5) Cédric Romilly et al. (2020) An RNA pseudoknot is essential for standby-mediated translation of the tisB toxin mRNA in Escherichia coli. Nucleic Acids Research 48(21):12336-12347. [PubMed:33231643]