Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | tisB-istR/- |
| Location | 3739474..3739998 | Replicon | chromosome |
| Accession | NC_012759 | ||
| Organism | Escherichia coli BW2952 | ||
| T1TAdb ID | TA06429 | ||
Toxin (Protein)
| Gene name | tisB | Uniprot ID | A0A094VG05 |
| Locus tag | BWG_3365 | Protein ID | WP_001054909.1 |
| Coordinates | 3739909..3739998 (+) | Length | 30 a.a. |
Antitoxin (RNA)
| Gene name | istR | ||
| Locus tag | BWG_4258 | ||
| Coordinates | 3739471..3739554 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| BWG_RS18520 (BWG_3359) | 3734990..3736492 | - | 1503 | WP_001295243.1 | signal transduction histidine-protein kinase/phosphatase UhpB | - |
| BWG_RS18525 (BWG_3360) | 3736492..3737082 | - | 591 | WP_000633668.1 | transcriptional regulator UhpA | - |
| BWG_RS18530 (BWG_3361) | 3737158..3737448 | - | 291 | WP_001181706.1 | acetolactate synthase small subunit | - |
| BWG_RS18535 (BWG_3362) | 3737452..3739140 | - | 1689 | WP_000168475.1 | acetolactate synthase large subunit | - |
| BWG_RS18540 (BWG_3363) | 3739246..3739344 | - | 99 | WP_001300753.1 | ilvB operon leader peptide IvbL | - |
| - | 3739471..3739554 | - | 84 | - | - | Antitoxin |
| BWG_RS18555 (BWG_3365) | 3739909..3739998 | + | 90 | WP_001054909.1 | type I toxin-antitoxin system toxin TisB | Toxin |
| BWG_RS18560 (BWG_3366) | 3740278..3741462 | + | 1185 | WP_000828746.1 | multidrug efflux MFS transporter EmrD | - |
| BWG_RS18565 (BWG_3367) | 3741470..3741967 | - | 498 | WP_000148061.1 | radical SAM protein | - |
| BWG_RS18570 (BWG_3368) | 3741964..3742326 | - | 363 | WP_001113432.1 | DUF202 domain-containing protein | - |
| BWG_RS18575 (BWG_3369) | 3742316..3742663 | - | 348 | WP_000703959.1 | YidH family protein | - |
| BWG_RS18580 (BWG_3370) | 3742771..3743220 | + | 450 | WP_000511289.1 | hypothetical protein | - |
| BWG_RS18585 (BWG_3371) | 3743267..3744760 | - | 1494 | WP_000828527.1 | sulfatase-like hydrolase/transferase | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 30 a.a. Molecular weight: 3222.10 Da Isoelectric Point: 8.6905
>T6349 WP_001054909.1 NC_012759:3739909-3739998 [Escherichia coli BW2952]
MNLVDIAILILKLIVAALQLLDAVLKYLK
MNLVDIAILILKLIVAALQLLDAVLKYLK
Download Length: 90 bp
>T6349 NC_012759:3739909-3739998 [Escherichia coli BW2952]
ATGAACCTGGTGGATATCGCCATTCTTATCCTCAAACTCATTGTTGCAGCACTGCAACTGCTTGATGCTGTTCTGAAATA
CCTGAAGTAA
ATGAACCTGGTGGATATCGCCATTCTTATCCTCAAACTCATTGTTGCAGCACTGCAACTGCTTGATGCTGTTCTGAAATA
CCTGAAGTAA
Antitoxin
Download Length: 84 bp
>AT6349 NC_012759:c3739554-3739471 [Escherichia coli BW2952]
TTCAGTGTTGACATAATACAGTGTGCTTTGCGGTTACCAGCCGCAGGCGACTGACGAAACCTCGCTCCGGCGGGGTTTTT
TGTT
TTCAGTGTTGACATAATACAGTGTGCTTTGCGGTTACCAGCCGCAGGCGACTGACGAAACCTCGCTCCGGCGGGGTTTTT
TGTT
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| T6350 | Escherichia coli str. K-12 substr. MG1655 |
100 |
100 |
1 |
Multiple sequence alignment
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
References
(1) Elizabeth M Fozo et al. (2010) Abundance of type I toxin-antitoxin systems in bacteria: searches for new candidates and discovery of novel families. Nucleic Acids Research 38(11):3743-59. [PubMed:20156992]
(2) Jörg Vogel et al. (2004) The small RNA IstR inhibits synthesis of an SOS-induced toxic peptide. Current Biology : CB 14(24):2271-6. [PubMed:15620655]