Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2087966..2088111 Replicon chromosome
Accession NZ_AP023311
Organism Salmonella enterica subsp. enterica serovar 4[5]12:i:- strain L-4596

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2088006..2088109 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2087966..2088111 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
K5674_RS10165 2084392..2085090 - 699 WP_000944282.1 exodeoxyribonuclease X -
K5674_RS10170 2085114..2085770 - 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
K5674_RS10175 2085878..2086108 - 231 WP_000856224.1 DNA polymerase III subunit theta -
K5674_RS10180 2086246..2086620 + 375 WP_000168393.1 CopC domain-containing protein YobA -
K5674_RS10185 2086621..2087496 + 876 WP_000979702.1 copper homeostasis membrane protein CopD -
K5674_RS10190 2087513..2087866 + 354 WP_000722368.1 YebY family protein -
- 2087966..2088111 - 146 - - Antitoxin
- 2088006..2088109 + 104 - - Toxin
K5674_RS10195 2088240..2089163 - 924 Protein_2003 tyrosine-type recombinase/integrase -
K5674_RS25215 2089427..2089888 - 462 Protein_2004 DNA breaking-rejoining protein -
K5674_RS10205 2089877..2090068 + 192 Protein_2005 glycoside hydrolase family 19 protein -
K5674_RS10210 2090122..2090655 + 534 WP_001050882.1 DUF2514 domain-containing protein -
K5674_RS10215 2090912..2091079 - 168 WP_000789530.1 lytic enzyme -
K5674_RS10220 2091144..2091332 - 189 WP_001521334.1 hypothetical protein -
K5674_RS10225 2091387..2091647 + 261 Protein_2009 DUF1441 family protein -
K5674_RS10230 2091862..2092206 + 345 Protein_2010 macro domain-containing protein -
K5674_RS10235 2092216..2092686 + 471 Protein_2011 tail fiber assembly protein -
K5674_RS10240 2092783..2092983 - 201 WP_010989029.1 PagK family vesicle-borne virulence factor -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2084392..2105691 21299


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T37479 NZ_AP023311:2088006-2088109 [Salmonella enterica subsp. enterica serovar 4,[5],12:i:-]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT37479 NZ_AP023311:c2088111-2087966 [Salmonella enterica subsp. enterica serovar 4,[5],12:i:-]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References