Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2127332..2127477 | Replicon | chromosome |
| Accession | NZ_OU015342 | ||
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00007171 isolate AUSMDU00007171 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2127372..2127475 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2127332..2127477 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| KKQ83_RS10375 | 2123758..2124456 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| KKQ83_RS10380 | 2124480..2125136 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| KKQ83_RS10385 | 2125244..2125474 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| KKQ83_RS10390 | 2125612..2125986 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| KKQ83_RS10395 | 2125987..2126862 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| KKQ83_RS10400 | 2126879..2127232 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2127332..2127477 | - | 146 | - | - | Antitoxin |
| - | 2127372..2127475 | + | 104 | - | - | Toxin |
| KKQ83_RS10405 | 2127606..2128529 | - | 924 | Protein_2048 | tyrosine-type recombinase/integrase | - |
| KKQ83_RS24530 | 2128793..2129254 | - | 462 | Protein_2049 | DNA breaking-rejoining protein | - |
| KKQ83_RS10415 | 2129243..2129434 | + | 192 | Protein_2050 | glycoside hydrolase family 19 protein | - |
| KKQ83_RS10420 | 2129488..2130021 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| KKQ83_RS10425 | 2130278..2130445 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| KKQ83_RS10430 | 2130510..2130698 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| KKQ83_RS10435 | 2130753..2131013 | + | 261 | Protein_2054 | DUF1441 family protein | - |
| KKQ83_RS10440 | 2131228..2131572 | + | 345 | Protein_2055 | macro domain-containing protein | - |
| KKQ83_RS10445 | 2131582..2132052 | + | 471 | Protein_2056 | tail fiber assembly protein | - |
| KKQ83_RS10450 | 2132149..2132349 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2121672..2147063 | 25391 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T294660 NZ_OU015342:2127372-2127475 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT294660 NZ_OU015342:c2127477-2127332 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
