Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2107535..2107680 Replicon chromosome
Accession NZ_CP126138
Organism Salmonella enterica subsp. enterica serovar Kottbus strain DSK01

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2107575..2107678 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2107535..2107680 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
QNM33_RS10325 2103961..2104659 - 699 WP_000944282.1 exodeoxyribonuclease X -
QNM33_RS10330 2104683..2105339 - 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
QNM33_RS10335 2105447..2105677 - 231 WP_000856224.1 DNA polymerase III subunit theta -
QNM33_RS10340 2105815..2106189 + 375 WP_000168393.1 CopC domain-containing protein YobA -
QNM33_RS10345 2106190..2107065 + 876 WP_000979702.1 copper homeostasis membrane protein CopD -
QNM33_RS10350 2107082..2107435 + 354 WP_000722368.1 YebY family protein -
- 2107535..2107680 - 146 - - Antitoxin
- 2107575..2107678 + 104 - - Toxin
QNM33_RS10355 2107809..2108732 - 924 Protein_2023 tyrosine-type recombinase/integrase -
QNM33_RS10360 2108996..2109457 - 462 Protein_2024 DNA breaking-rejoining protein -
QNM33_RS10365 2109446..2109637 + 192 Protein_2025 glycoside hydrolase family 19 protein -
QNM33_RS10370 2109691..2110224 + 534 WP_001050882.1 DUF2514 domain-containing protein -
QNM33_RS10375 2110481..2110648 - 168 WP_000789530.1 lytic enzyme -
QNM33_RS10380 2110713..2110901 - 189 WP_001521334.1 hypothetical protein -
QNM33_RS10385 2110956..2111216 + 261 Protein_2029 DUF1441 family protein -
QNM33_RS10390 2111431..2111775 + 345 Protein_2030 macro domain-containing protein -
QNM33_RS10395 2111785..2112255 + 471 Protein_2031 tail fiber assembly protein -
QNM33_RS10400 2112352..2112552 - 201 WP_010989029.1 PagK family vesicle-borne virulence factor -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2101875..2127257 25382


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T282658 NZ_CP126138:2107575-2107678 [Salmonella enterica subsp. enterica serovar Kottbus]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT282658 NZ_CP126138:c2107680-2107535 [Salmonella enterica subsp. enterica serovar Kottbus]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References