Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2354218..2354363 | Replicon | chromosome |
| Accession | NZ_CP121298 | ||
| Organism | Salmonella enterica subsp. enterica strain KKP 3080 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2354258..2354361 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2354218..2354363 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| P1839_RS11235 | 2350644..2351342 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| P1839_RS11240 | 2351366..2352022 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| P1839_RS11245 | 2352130..2352360 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| P1839_RS11250 | 2352498..2352872 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| P1839_RS11255 | 2352873..2353748 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| P1839_RS11260 | 2353765..2354118 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2354218..2354363 | - | 146 | - | - | Antitoxin |
| - | 2354258..2354361 | + | 104 | - | - | Toxin |
| P1839_RS11265 | 2354492..2355415 | - | 924 | Protein_2180 | tyrosine-type recombinase/integrase | - |
| P1839_RS11270 | 2355679..2356140 | - | 462 | Protein_2181 | DNA breaking-rejoining protein | - |
| P1839_RS11275 | 2356129..2356320 | + | 192 | Protein_2182 | glycoside hydrolase family 19 protein | - |
| P1839_RS11280 | 2356374..2356907 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| P1839_RS11285 | 2357164..2357331 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| P1839_RS11290 | 2357396..2357584 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| P1839_RS11295 | 2357639..2357899 | + | 261 | Protein_2186 | DUF1441 family protein | - |
| P1839_RS11300 | 2357901..2358116 | + | 216 | Protein_2187 | shikimate transporter | - |
| P1839_RS11305 | 2358114..2358458 | + | 345 | Protein_2188 | macro domain-containing protein | - |
| P1839_RS11310 | 2358468..2358938 | + | 471 | Protein_2189 | tail fiber assembly protein | - |
| P1839_RS11315 | 2359035..2359235 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2348558..2373940 | 25382 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T276257 NZ_CP121298:2354258-2354361 [Salmonella enterica subsp. enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT276257 NZ_CP121298:c2354363-2354218 [Salmonella enterica subsp. enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG