Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2649726..2649869 | Replicon | chromosome |
| Accession | NZ_CP121068 | ||
| Organism | Salmonella enterica subsp. enterica serovar Infantis strain R21.1575 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2649728..2649831 (-) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2649726..2649869 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| P8I08_RS12925 | 2644856..2645056 | + | 201 | Protein_2533 | PagK family vesicle-borne virulence factor | - |
| P8I08_RS12930 | 2645153..2645664 | - | 512 | Protein_2534 | tail fiber assembly protein | - |
| P8I08_RS12935 | 2645677..2645964 | - | 288 | Protein_2535 | macro domain-containing protein | - |
| P8I08_RS12940 | 2645974..2646189 | - | 216 | Protein_2536 | shikimate transporter | - |
| P8I08_RS12945 | 2646191..2646451 | - | 261 | Protein_2537 | DUF1441 family protein | - |
| P8I08_RS12950 | 2646759..2646926 | + | 168 | WP_000789529.1 | lytic enzyme | - |
| P8I08_RS12955 | 2647183..2647716 | - | 534 | WP_001050883.1 | DUF2514 domain-containing protein | - |
| P8I08_RS12960 | 2647770..2647961 | - | 192 | Protein_2540 | glycoside hydrolase family 19 protein | - |
| P8I08_RS12965 | 2647950..2648411 | + | 462 | Protein_2541 | DNA breaking-rejoining protein | - |
| P8I08_RS12970 | 2648675..2649568 | + | 894 | Protein_2542 | tyrosine-type recombinase/integrase | - |
| - | 2649726..2649869 | + | 144 | - | - | Antitoxin |
| - | 2649728..2649831 | - | 104 | - | - | Toxin |
| P8I08_RS12975 | 2649971..2650324 | - | 354 | WP_000722368.1 | YebY family protein | - |
| P8I08_RS12980 | 2650341..2651216 | - | 876 | WP_000979694.1 | copper homeostasis membrane protein CopD | - |
| P8I08_RS12985 | 2651217..2651591 | - | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| P8I08_RS12990 | 2651729..2651959 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| P8I08_RS12995 | 2652067..2652723 | + | 657 | WP_000100256.1 | nitrilase-related carbon-nitrogen hydrolase | - |
| P8I08_RS13000 | 2652747..2653445 | + | 699 | WP_000944278.1 | exodeoxyribonuclease X | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2624875..2655531 | 30656 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T275561 NZ_CP121068:c2649831-2649728 [Salmonella enterica subsp. enterica serovar Infantis]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT275561 NZ_CP121068:2649726-2649869 [Salmonella enterica subsp. enterica serovar Infantis]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
