Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 4501108..4501253 | Replicon | chromosome |
Accession | NZ_CP120671 | ||
Organism | Salmonella enterica strain SC2020597 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 4501110..4501213 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 4501108..4501253 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
P4B13_RS21695 | 4496390..4496734 | - | 345 | Protein_4231 | macro domain-containing protein | - |
P4B13_RS21700 | 4496949..4497209 | - | 261 | Protein_4232 | DUF1441 family protein | - |
P4B13_RS21705 | 4497517..4497684 | + | 168 | WP_000789530.1 | lytic enzyme | - |
P4B13_RS21710 | 4497941..4498473 | - | 533 | Protein_4234 | DUF2514 domain-containing protein | - |
P4B13_RS21715 | 4498527..4498718 | - | 192 | Protein_4235 | glycoside hydrolase family 19 protein | - |
P4B13_RS21720 | 4498707..4499858 | + | 1152 | Protein_4236 | PD-(D/E)XK nuclease-like domain-containing protein | - |
P4B13_RS21725 | 4499891..4500970 | + | 1080 | WP_017466154.1 | phage integrase Arm DNA-binding domain-containing protein | - |
- | 4501108..4501253 | + | 146 | - | - | Antitoxin |
- | 4501110..4501213 | - | 104 | - | - | Toxin |
P4B13_RS21730 | 4501353..4501706 | - | 354 | WP_017466155.1 | YebY family protein | - |
P4B13_RS21735 | 4501723..4502598 | - | 876 | WP_017466156.1 | copper homeostasis membrane protein CopD | - |
P4B13_RS21740 | 4502599..4502973 | - | 375 | WP_022544651.1 | CopC domain-containing protein YobA | - |
P4B13_RS21745 | 4503111..4503341 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
P4B13_RS21750 | 4503449..4504105 | + | 657 | WP_000100249.1 | carbon-nitrogen hydrolase family protein | - |
P4B13_RS21755 | 4504129..4504827 | + | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
inside | Prophage | - | sopE2 | 4479751..4506915 | 27164 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T275342 NZ_CP120671:c4501213-4501110 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT275342 NZ_CP120671:4501108-4501253 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG