Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2043829..2043974 Replicon chromosome
Accession NZ_CP113541
Organism Salmonella enterica strain CHC

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2043869..2043972 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2043829..2043974 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
OXV05_RS09730 2040255..2040953 - 699 WP_000944282.1 exodeoxyribonuclease X -
OXV05_RS09735 2040977..2041633 - 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
OXV05_RS09740 2041741..2041971 - 231 WP_000856224.1 DNA polymerase III subunit theta -
OXV05_RS09745 2042109..2042483 + 375 WP_000168393.1 CopC domain-containing protein YobA -
OXV05_RS09750 2042484..2043359 + 876 WP_000979702.1 copper homeostasis membrane protein CopD -
OXV05_RS09755 2043376..2043729 + 354 WP_000722368.1 YebY family protein -
- 2043829..2043974 - 146 - - Antitoxin
- 2043869..2043972 + 104 - - Toxin
OXV05_RS09760 2044103..2045026 - 924 Protein_1907 tyrosine-type recombinase/integrase -
OXV05_RS09765 2045290..2045751 - 462 Protein_1908 DNA breaking-rejoining protein -
OXV05_RS09770 2045740..2045931 + 192 Protein_1909 glycoside hydrolase family 19 protein -
OXV05_RS09775 2045985..2046518 + 534 WP_001050882.1 DUF2514 domain-containing protein -
OXV05_RS09780 2046775..2046942 - 168 WP_000789530.1 lytic enzyme -
OXV05_RS09785 2047007..2047195 - 189 WP_001521334.1 hypothetical protein -
OXV05_RS09790 2047250..2047510 + 261 Protein_1913 DUF1441 family protein -
OXV05_RS09795 2047512..2047727 + 216 Protein_1914 shikimate transporter -
OXV05_RS09800 2047725..2048069 + 345 Protein_1915 macro domain-containing protein -
OXV05_RS09805 2048079..2048549 + 471 Protein_1916 tail fiber assembly protein -
OXV05_RS09810 2048646..2048846 - 201 WP_010989029.1 PagK family vesicle-borne virulence factor -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2038169..2063551 25382


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T266012 NZ_CP113541:2043869-2043972 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT266012 NZ_CP113541:c2043974-2043829 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References