Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2106696..2106841 | Replicon | chromosome |
| Accession | NZ_CP098834 | ||
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium strain GD19PS1 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2106736..2106839 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2106696..2106841 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| NFH28_RS10325 | 2103122..2103820 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| NFH28_RS10330 | 2103844..2104500 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| NFH28_RS10335 | 2104608..2104838 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| NFH28_RS10340 | 2104976..2105350 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| NFH28_RS10345 | 2105351..2106226 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| NFH28_RS10350 | 2106243..2106596 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2106696..2106841 | - | 146 | - | - | Antitoxin |
| - | 2106736..2106839 | + | 104 | - | - | Toxin |
| NFH28_RS10355 | 2106970..2107893 | - | 924 | Protein_2030 | tyrosine-type recombinase/integrase | - |
| NFH28_RS10360 | 2108157..2108618 | - | 462 | Protein_2031 | DNA breaking-rejoining protein | - |
| NFH28_RS10365 | 2108607..2108798 | + | 192 | Protein_2032 | glycoside hydrolase family 19 protein | - |
| NFH28_RS10370 | 2108852..2109385 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| NFH28_RS10375 | 2109642..2109809 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| NFH28_RS10380 | 2109874..2110062 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| NFH28_RS10385 | 2110117..2110377 | + | 261 | Protein_2036 | DUF1441 family protein | - |
| NFH28_RS10390 | 2110592..2110936 | + | 345 | Protein_2037 | macro domain-containing protein | - |
| NFH28_RS10395 | 2110946..2111416 | + | 471 | Protein_2038 | tail fiber assembly protein | - |
| NFH28_RS10400 | 2111513..2111713 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2101036..2126427 | 25391 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T248152 NZ_CP098834:2106736-2106839 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT248152 NZ_CP098834:c2106841-2106696 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
