Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2117494..2117639 Replicon chromosome
Accession NZ_CP093386
Organism Salmonella enterica strain P048595

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2117534..2117637 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2117494..2117639 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
MOQ57_RS10300 2113920..2114618 - 699 WP_000944282.1 exodeoxyribonuclease X -
MOQ57_RS10305 2114642..2115298 - 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
MOQ57_RS10310 2115406..2115636 - 231 WP_000856224.1 DNA polymerase III subunit theta -
MOQ57_RS10315 2115774..2116148 + 375 WP_000168393.1 CopC domain-containing protein YobA -
MOQ57_RS10320 2116149..2117024 + 876 WP_000979702.1 copper homeostasis membrane protein CopD -
MOQ57_RS10325 2117041..2117394 + 354 WP_000722368.1 YebY family protein -
- 2117494..2117639 - 146 - - Antitoxin
- 2117534..2117637 + 104 - - Toxin
MOQ57_RS10330 2117768..2118691 - 924 Protein_2026 tyrosine-type recombinase/integrase -
MOQ57_RS10335 2118955..2119416 - 462 Protein_2027 DNA breaking-rejoining protein -
MOQ57_RS10340 2119405..2119596 + 192 Protein_2028 glycoside hydrolase family 19 protein -
MOQ57_RS10345 2119650..2120183 + 534 WP_001050882.1 DUF2514 domain-containing protein -
MOQ57_RS10350 2120440..2120607 - 168 WP_000789530.1 lytic enzyme -
MOQ57_RS10355 2120672..2120860 - 189 WP_001521334.1 hypothetical protein -
MOQ57_RS10360 2120915..2121175 + 261 Protein_2032 DUF1441 family protein -
MOQ57_RS10365 2121390..2121734 + 345 Protein_2033 macro domain-containing protein -
MOQ57_RS10370 2121744..2122214 + 471 Protein_2034 tail fiber assembly protein -
MOQ57_RS10375 2122311..2122511 - 201 WP_010989029.1 PagK family vesicle-borne virulence factor -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2111834..2137217 25383


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T238354 NZ_CP093386:2117534-2117637 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT238354 NZ_CP093386:c2117639-2117494 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References