Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 1259338..1259481 Replicon chromosome
Accession NZ_CP085981
Organism Salmonella enterica strain SZL 30

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 1259340..1259443 (-)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 1259338..1259481 (+)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
LJY16_RS06525 1254468..1254668 + 201 WP_010989029.1 PagK family vesicle-borne virulence factor -
LJY16_RS06530 1254765..1255276 - 512 Protein_1209 tail fiber assembly protein -
LJY16_RS24375 1255289..1255576 - 288 Protein_1210 macro domain-containing protein -
LJY16_RS24380 1255586..1255801 - 216 Protein_1211 shikimate transporter -
LJY16_RS06540 1255803..1256063 - 261 Protein_1212 DUF1441 family protein -
LJY16_RS06545 1256371..1256538 + 168 WP_000789529.1 lytic enzyme -
LJY16_RS06550 1256795..1257328 - 534 WP_001050883.1 DUF2514 domain-containing protein -
LJY16_RS06555 1257382..1257573 - 192 Protein_1215 glycoside hydrolase family 19 protein -
LJY16_RS06560 1257562..1258023 + 462 Protein_1216 DNA breaking-rejoining protein -
LJY16_RS06565 1258287..1259180 + 894 Protein_1217 tyrosine-type recombinase/integrase -
- 1259338..1259481 + 144 - - Antitoxin
- 1259340..1259443 - 104 - - Toxin
LJY16_RS06570 1259583..1259936 - 354 WP_000722368.1 YebY family protein -
LJY16_RS06575 1259953..1260828 - 876 WP_000979694.1 copper homeostasis membrane protein CopD -
LJY16_RS06580 1260829..1261203 - 375 WP_000168393.1 CopC domain-containing protein YobA -
LJY16_RS06585 1261341..1261571 + 231 WP_000856224.1 DNA polymerase III subunit theta -
LJY16_RS06590 1261679..1262335 + 657 WP_000100256.1 nitrilase-related carbon-nitrogen hydrolase -
LJY16_RS06595 1262359..1263057 + 699 WP_000944278.1 exodeoxyribonuclease X -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 1234487..1265143 30656


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T222357 NZ_CP085981:c1259443-1259340 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 144 bp

>AT222357 NZ_CP085981:1259338-1259481 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References