Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2131621..2131766 Replicon chromosome
Accession NZ_CP085699
Organism Salmonella enterica subsp. enterica serovar Typhimurium strain S29

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2131661..2131764 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2131621..2131766 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
LJN59_RS10455 2128047..2128745 - 699 WP_000944282.1 exodeoxyribonuclease X -
LJN59_RS10460 2128769..2129425 - 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
LJN59_RS10465 2129533..2129763 - 231 WP_000856224.1 DNA polymerase III subunit theta -
LJN59_RS10470 2129901..2130275 + 375 WP_000168393.1 CopC domain-containing protein YobA -
LJN59_RS10475 2130276..2131151 + 876 WP_000979702.1 copper homeostasis membrane protein CopD -
LJN59_RS10480 2131168..2131521 + 354 WP_000722368.1 YebY family protein -
- 2131621..2131766 - 146 - - Antitoxin
- 2131661..2131764 + 104 - - Toxin
LJN59_RS10485 2131895..2132818 - 924 Protein_2052 tyrosine-type recombinase/integrase -
LJN59_RS10490 2133082..2133543 - 462 Protein_2053 DNA breaking-rejoining protein -
LJN59_RS10495 2133532..2133723 + 192 Protein_2054 glycoside hydrolase family 19 protein -
LJN59_RS10500 2133777..2134310 + 534 WP_001050882.1 DUF2514 domain-containing protein -
LJN59_RS10505 2134567..2134734 - 168 WP_000789530.1 lytic enzyme -
LJN59_RS10510 2134799..2134987 - 189 WP_001521334.1 hypothetical protein -
LJN59_RS10515 2135042..2135302 + 261 Protein_2058 DUF1441 family protein -
LJN59_RS10520 2135517..2135861 + 345 Protein_2059 macro domain-containing protein -
LJN59_RS10525 2135871..2136341 + 471 Protein_2060 tail fiber assembly protein -
LJN59_RS10530 2136438..2136638 - 201 WP_010989029.1 PagK family vesicle-borne virulence factor -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2124284..2149136 24852


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T221092 NZ_CP085699:2131661-2131764 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT221092 NZ_CP085699:c2131766-2131621 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References