Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2131621..2131766 | Replicon | chromosome |
| Accession | NZ_CP085699 | ||
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium strain S29 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2131661..2131764 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2131621..2131766 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| LJN59_RS10455 | 2128047..2128745 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| LJN59_RS10460 | 2128769..2129425 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| LJN59_RS10465 | 2129533..2129763 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| LJN59_RS10470 | 2129901..2130275 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| LJN59_RS10475 | 2130276..2131151 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| LJN59_RS10480 | 2131168..2131521 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2131621..2131766 | - | 146 | - | - | Antitoxin |
| - | 2131661..2131764 | + | 104 | - | - | Toxin |
| LJN59_RS10485 | 2131895..2132818 | - | 924 | Protein_2052 | tyrosine-type recombinase/integrase | - |
| LJN59_RS10490 | 2133082..2133543 | - | 462 | Protein_2053 | DNA breaking-rejoining protein | - |
| LJN59_RS10495 | 2133532..2133723 | + | 192 | Protein_2054 | glycoside hydrolase family 19 protein | - |
| LJN59_RS10500 | 2133777..2134310 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| LJN59_RS10505 | 2134567..2134734 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| LJN59_RS10510 | 2134799..2134987 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| LJN59_RS10515 | 2135042..2135302 | + | 261 | Protein_2058 | DUF1441 family protein | - |
| LJN59_RS10520 | 2135517..2135861 | + | 345 | Protein_2059 | macro domain-containing protein | - |
| LJN59_RS10525 | 2135871..2136341 | + | 471 | Protein_2060 | tail fiber assembly protein | - |
| LJN59_RS10530 | 2136438..2136638 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2124284..2149136 | 24852 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T221092 NZ_CP085699:2131661-2131764 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT221092 NZ_CP085699:c2131766-2131621 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG