Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1991555..1991679 | Replicon | chromosome |
Accession | NC_008800 | ||
Organism | Yersinia enterocolitica subsp. enterocolitica 8081 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1991577..1991671 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1991555..1991679 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
YE_RS09005 (YE1793) | 1987170..1988126 | + | 957 | WP_011816174.1 | prolyl aminopeptidase | - |
YE_RS09010 (YE1794) | 1988176..1988409 | - | 234 | WP_004389928.1 | DNA polymerase III subunit theta | - |
YE_RS09015 (YE1795) | 1988793..1989302 | + | 510 | WP_005170444.1 | non-heme ferritin | - |
YE_RS09020 (YE1796) | 1989693..1990079 | + | 387 | WP_005170441.1 | CopC domain-containing protein YobA | - |
YE_RS09025 (YE1797) | 1990081..1990965 | + | 885 | WP_005170439.1 | copper homeostasis membrane protein CopD | - |
YE_RS09030 (YE1798) | 1991062..1991403 | + | 342 | WP_005170437.1 | YebY family protein | - |
- | 1991555..1991679 | - | 125 | - | - | Antitoxin |
- | 1991577..1991671 | + | 95 | - | - | Toxin |
YE_RS09035 (YE1799) | 1991747..1992855 | - | 1109 | Protein_1742 | tyrosine-type recombinase/integrase | - |
YE_RS09045 (YE1800) | 1992830..1993099 | - | 270 | WP_011816177.1 | excisionase | - |
YE_RS09050 (YE1801) | 1993206..1993532 | - | 327 | WP_050942006.1 | hypothetical protein | - |
YE_RS09055 (YE1802) | 1993532..1993870 | - | 339 | WP_011816179.1 | hypothetical protein | - |
YE_RS09060 (YE1803) | 1993951..1994844 | - | 894 | Protein_1746 | IS3 family transposase | - |
YE_RS09065 (YE1804) | 1994927..1995937 | + | 1011 | Protein_1747 | oxidoreductase | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | ail | 1984654..2022489 | 37835 | |
flank | IS/Tn | - | - | 1985629..1986633 | 1004 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 95 bp
>T21933 NC_008800:1991577-1991671 [Yersinia enterocolitica subsp. enterocolitica 8081]
AACAAGCCTACGTTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATCGT
ATTCGGTCTCTTTTT
AACAAGCCTACGTTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATCGT
ATTCGGTCTCTTTTT
Antitoxin
Download Length: 125 bp
>AT21933 NC_008800:c1991679-1991555 [Yersinia enterocolitica subsp. enterocolitica 8081]
AACAAATTAAAAAGAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAA
GTTGGCATTAACGTAGGCTTGTTCAGCCATACTCTTTAAGAGTAG
AACAAATTAAAAAGAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAA
GTTGGCATTAACGTAGGCTTGTTCAGCCATACTCTTTAAGAGTAG