Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1335581..1335699 | Replicon | chromosome |
Accession | NZ_LR590469 | ||
Organism | Yersinia enterocolitica subsp. enterocolitica strain NCTC12982 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1335583..1335677 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1335581..1335699 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
FGL26_RS06380 | 1332400..1332852 | + | 453 | WP_005170432.1 | phage tail protein | - |
FGL26_RS06385 | 1332849..1333991 | + | 1143 | WP_005170434.1 | phage late control D family protein | - |
FGL26_RS06390 | 1334084..1334302 | + | 219 | WP_005170435.1 | DNA-binding transcriptional regulator | - |
FGL26_RS06395 | 1334455..1335525 | + | 1071 | WP_032912738.1 | tyrosine-type recombinase/integrase | - |
- | 1335581..1335699 | + | 119 | - | - | Antitoxin |
- | 1335583..1335677 | - | 95 | - | - | Toxin |
FGL26_RS06400 | 1335851..1336192 | - | 342 | WP_005170437.1 | YebY family protein | - |
FGL26_RS06405 | 1336289..1337173 | - | 885 | WP_005170439.1 | copper homeostasis membrane protein CopD | - |
FGL26_RS06410 | 1337175..1337561 | - | 387 | WP_005170441.1 | CopC domain-containing protein YobA | - |
FGL26_RS06415 | 1337964..1338473 | - | 510 | WP_005170444.1 | non-heme ferritin | - |
FGL26_RS06420 | 1338857..1339090 | + | 234 | WP_004389928.1 | DNA polymerase III subunit theta | - |
FGL26_RS06425 | 1339140..1340096 | - | 957 | WP_005170448.1 | prolyl aminopeptidase | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | pilW / pilW | 1286973..1339090 | 52117 | |
flank | IS/Tn | - | - | 1340633..1341637 | 1004 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 95 bp
>T288473 NZ_LR590469:c1335677-1335583 [Yersinia enterocolitica subsp. enterocolitica]
AACAAGCCTACGTTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATCGT
ATTCGGTCTTTTTTT
AACAAGCCTACGTTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATCGT
ATTCGGTCTTTTTTT
Antitoxin
Download Length: 119 bp
>AT288473 NZ_LR590469:1335581-1335699 [Yersinia enterocolitica subsp. enterocolitica]
ATAAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAACGTAGGCTTGTTCAGCCATACTCTTTAAGAGTAG
ATAAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAACGTAGGCTTGTTCAGCCATACTCTTTAAGAGTAG