Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2135844..2135989 | Replicon | chromosome |
| Accession | NZ_CP047546 | ||
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium strain SJTUF10236 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2135884..2135987 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2135844..2135989 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| DXN28_RS10430 | 2132270..2132968 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| DXN28_RS10435 | 2132992..2133648 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| DXN28_RS10440 | 2133756..2133986 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| DXN28_RS10445 | 2134124..2134498 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| DXN28_RS10450 | 2134499..2135374 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| DXN28_RS10455 | 2135391..2135744 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2135844..2135989 | - | 146 | - | - | Antitoxin |
| - | 2135884..2135987 | + | 104 | - | - | Toxin |
| DXN28_RS10460 | 2136118..2137041 | - | 924 | Protein_2051 | tyrosine-type recombinase/integrase | - |
| DXN28_RS10465 | 2137305..2137766 | - | 462 | Protein_2052 | DNA breaking-rejoining protein | - |
| DXN28_RS10470 | 2137755..2137946 | + | 192 | Protein_2053 | glycoside hydrolase family 19 protein | - |
| DXN28_RS10475 | 2138000..2138533 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| DXN28_RS10480 | 2138790..2138957 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| DXN28_RS10485 | 2139022..2139210 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| DXN28_RS10490 | 2139265..2139525 | + | 261 | Protein_2057 | DUF1441 family protein | - |
| DXN28_RS10495 | 2139740..2140084 | + | 345 | Protein_2058 | macro domain-containing protein | - |
| DXN28_RS10500 | 2140094..2140564 | + | 471 | Protein_2059 | tail fiber assembly protein | - |
| DXN28_RS10505 | 2140661..2140861 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2132270..2153569 | 21299 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T146593 NZ_CP047546:2135884-2135987 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT146593 NZ_CP047546:c2135989-2135844 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG