Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | AapC-IsoC/- |
| Location | 479785..479872 | Replicon | chromosome |
| Accession | NC_000915 | ||
| Organism | Helicobacter pylori 26695 | ||
| T1TAdb ID | TA03828 | ||
Toxin (Protein)
| Gene name | AapC | Uniprot ID | - |
| Locus tag | - | Protein ID | - |
| Coordinates | 479822..479872 (+) | Length | 17 a.a. |
Antitoxin (RNA)
| Gene name | IsoC | ||
| Locus tag | - | ||
| Coordinates | 479785..479856 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| HP_RS02250 (HP0456a) | 474833..475063 | + | 231 | WP_000189081.1 | hypothetical protein | - |
| HP_RS02255 (HP0456) | 475056..475508 | + | 453 | WP_010875490.1 | hypothetical protein | - |
| HP_RS02260 | 475531..475814 | + | 284 | Protein_431 | TrbC/VirB2 family protein | - |
| HP_RS02265 (HP0457) | 475826..476089 | + | 264 | WP_001177716.1 | hypothetical protein | - |
| HP_RS02270 (HP0458) | 476101..476337 | + | 237 | WP_001168532.1 | hypothetical protein | - |
| HP_RS02275 (HP0459) | 476337..478913 | + | 2577 | WP_000893960.1 | VirB4 family type IV secretion/conjugal transfer ATPase | - |
| HP_RS02280 (HP_0460) | 479043..479519 | + | 477 | Protein_435 | hypothetical protein | - |
| - | 479785..479856 | - | 72 | - | - | Antitoxin |
| - | 479822..479872 | + | 51 | - | - | Toxin |
| HP_RS02285 (HP0462) | 480062..481159 | - | 1098 | WP_000005927.1 | restriction endonuclease subunit S | - |
| HP_RS02290 (HP0463) | 481152..482782 | - | 1631 | Protein_437 | SAM-dependent DNA methyltransferase | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 17 a.a. Molecular weight: 1819.34 Da Isoelectric Point: 8.7990
>T10214 - NC_000915:479822-479872 [Helicobacter pylori 26695]
MRLVIIVLMVSATPLY
MRLVIIVLMVSATPLY
Download Length: 51 bp
>T10214 NC_000915:479822-479872 [Helicobacter pylori 26695]
ATGAGATTAGTAATCATAGTTTTAATGGTATCCGCAACGCCATTATACTAA
ATGAGATTAGTAATCATAGTTTTAATGGTATCCGCAACGCCATTATACTAA
Antitoxin
Download Length: 72 bp
>AT10214 NC_000915:c479856-479785 [Helicobacter pylori 26695]
GCGGATACCATTAAAACTATGATTACTAATCTCATGTTAGGTTATCTCCTTTTCTGAGGTAACCACCCACTA
GCGGATACCATTAAAACTATGATTACTAATCTCATGTTAGGTTATCTCCTTTTCTGAGGTAACCACCCACTA
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| T10215 | Helicobacter pylori 26695 |
100 |
100 |
1 |
Multiple sequence alignment
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
References
(1) Cynthia M Sharma et al. (2010) The primary transcriptome of the major human pathogen Helicobacter pylori. Nature 464(7286):250-5. [PubMed:20164839]