Detailed information of TA system
Experimentally validatedOverview
TA module
Type | I | Classification (family/domain) | sprG-sprF/- |
Location | 25102..25357 | Replicon | chromosome |
Accession | NZ_JPPU01000003 | ||
Organism | Staphylococcus aureus strain HG003 isolate RN1 Scaffold_3 |
Toxin (Protein)
Gene name | SprG3 | Uniprot ID | - |
Locus tag | - | Protein ID | - |
Coordinates | 25102..25179 (+) | Length | 26 a.a. |
Antitoxin (RNA)
Gene name | SprF3 | ||
Locus tag | - | ||
Coordinates | 25178..25357 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
IM26_RS17645 (IM26_02515) | 20462..21244 | + | 783 | WP_000908177.1 | ABC transporter ATP-binding protein | - |
IM26_RS17650 (IM26_02520) | 21312..22169 | + | 858 | WP_000370924.1 | HAD family hydrolase | - |
IM26_RS29210 | 22401..22585 | - | 185 | Protein_12 | exotoxin | - |
IM26_RS0113820 | 22874..22966 | - | 93 | WP_001790138.1 | hypothetical protein | - |
IM26_RS17655 (IM26_02525) | 23255..24391 | + | 1137 | WP_000115562.1 | SAP domain-containing protein | - |
IM26_RS29040 | 24434..24917 | + | 484 | Protein_15 | recombinase family protein | - |
- | 25102..25179 | + | 78 | - | - | Toxin |
- | 25178..25357 | - | 180 | - | - | Antitoxin |
IM26_RS17665 (IM26_02535) | 25625..26716 | - | 1092 | WP_000495671.1 | lytic regulatory protein | - |
IM26_RS17670 (IM26_02540) | 26982..27962 | - | 981 | WP_000019744.1 | CDF family zinc efflux transporter CzrB | - |
IM26_RS17675 (IM26_02545) | 27964..28284 | - | 321 | WP_000003759.1 | Zn(II)-responsive metalloregulatory transcriptional repressor CzrA | - |
IM26_RS17680 (IM26_02550) | 28436..29101 | + | 666 | WP_001024094.1 | SDR family oxidoreductase | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 26 a.a. Molecular weight: 2962.61 Da Isoelectric Point: 5.4974
>T10147 - NZ_JPPU01000003:25102-25179 [Staphylococcus aureus]
MSDFEMLMVVLTIIGLVLISTQDHKK
MSDFEMLMVVLTIIGLVLISTQDHKK
Download Length: 78 bp
>T10147 NZ_JPPU01000003:25102-25179 [Staphylococcus aureus]
ATGTCTGATTTTGAAATGCTTATGGTTGTATTAACAATCATTGGTTTAGTATTGATTAGTACTCAAGACCATAAAAAA
ATGTCTGATTTTGAAATGCTTATGGTTGTATTAACAATCATTGGTTTAGTATTGATTAGTACTCAAGACCATAAAAAA
Antitoxin
Download Length: 180 bp
>AT10147 NZ_JPPU01000003:c25357-25178 [Staphylococcus aureus]
GTGTTAAAATATATTTGTAGCAAGTAGAAGCAAAAGATGAAAATCATTAACTCTTGAAACACAAAAAGGGCAACACTCGG
AAACATGTTACCCTAATGAGCCCGTTAAAAAGACGGTGACCTTATATTTTATTTAAAAATAGCCTTCAAAAATGCCGGTC
AAAGCGAATAGAAGGTTATT
GTGTTAAAATATATTTGTAGCAAGTAGAAGCAAAAGATGAAAATCATTAACTCTTGAAACACAAAAAGGGCAACACTCGG
AAACATGTTACCCTAATGAGCCCGTTAAAAAGACGGTGACCTTATATTTTATTTAAAAATAGCCTTCAAAAATGCCGGTC
AAAGCGAATAGAAGGTTATT
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|---|---|---|---|
T10026 | Staphylococcus aureus subsp. aureus N315 |
100 |
100 |
1 |
Multiple sequence alignment
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
References
(1) Camille Riffaud et al. (2019) Functionality and cross-regulation of the four SprG/SprF type I toxin-antitoxin systems in Staphylococcus aureus. Nucleic Acids Research 47(4):1740-1758. [PubMed:30551143]
experimental literature