Detailed information
Overview
| Name | comGE | Type | Machinery gene |
| Locus tag | AAEU35_RS08545 | Genome accession | NZ_CP152294 |
| Coordinates | 1709498..1709794 (+) | Length | 98 a.a. |
| NCBI ID | WP_058223572.1 | Uniprot ID | - |
| Organism | Lactococcus lactis strain Q13 | ||
| Function | dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology) DNA binding and uptake |
||
Related MGE
Note: This gene co-localizes with putative mobile genetic elements (MGEs) in the genome predicted by VRprofile2, as detailed below.
Gene-MGE association summary
| MGE type | MGE coordinates | Gene coordinates | Relative position | Distance (bp) |
|---|---|---|---|---|
| Prophage | 1672790..1720741 | 1709498..1709794 | within | 0 |
Gene organization within MGE regions
Location: 1672790..1720741
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| AAEU35_RS08245 | - | 1673823..1673963 (+) | 141 | WP_228777719.1 | hypothetical protein | - |
| AAEU35_RS08250 | - | 1673960..1675417 (-) | 1458 | WP_311929689.1 | recombinase family protein | - |
| AAEU35_RS08255 | - | 1675543..1676082 (-) | 540 | WP_023164651.1 | PH domain-containing protein | - |
| AAEU35_RS08260 | - | 1676137..1676721 (-) | 585 | WP_288625240.1 | hypothetical protein | - |
| AAEU35_RS08265 | - | 1676732..1677154 (-) | 423 | WP_317141376.1 | helix-turn-helix transcriptional regulator | - |
| AAEU35_RS08270 | - | 1677310..1677531 (+) | 222 | WP_317141375.1 | helix-turn-helix transcriptional regulator | - |
| AAEU35_RS08275 | - | 1677577..1678293 (+) | 717 | WP_317141374.1 | phage antirepressor KilAC domain-containing protein | - |
| AAEU35_RS08280 | - | 1678309..1678491 (+) | 183 | WP_003130605.1 | hypothetical protein | - |
| AAEU35_RS08285 | - | 1678488..1678610 (+) | 123 | WP_023164646.1 | hypothetical protein | - |
| AAEU35_RS08290 | - | 1678623..1678808 (+) | 186 | WP_038600407.1 | hypothetical protein | - |
| AAEU35_RS08295 | - | 1678840..1679013 (+) | 174 | WP_014573167.1 | putative transcriptional regulator | - |
| AAEU35_RS08300 | - | 1679114..1679980 (+) | 867 | WP_317141373.1 | recombinase RecT | - |
| AAEU35_RS08305 | - | 1679982..1680998 (+) | 1017 | WP_317141372.1 | DUF1351 domain-containing protein | - |
| AAEU35_RS08310 | - | 1681273..1682196 (+) | 924 | WP_317141371.1 | phage replisome organizer N-terminal domain-containing protein | - |
| AAEU35_RS08315 | - | 1682189..1682431 (+) | 243 | WP_317141370.1 | hypothetical protein | - |
| AAEU35_RS08320 | - | 1682440..1682859 (+) | 420 | WP_317141369.1 | RusA family crossover junction endodeoxyribonuclease | - |
| AAEU35_RS08325 | - | 1682967..1683173 (+) | 207 | WP_014570535.1 | hypothetical protein | - |
| AAEU35_RS08330 | - | 1683182..1683598 (+) | 417 | WP_317141368.1 | YopX family protein | - |
| AAEU35_RS08335 | - | 1683595..1683888 (+) | 294 | WP_317141367.1 | hypothetical protein | - |
| AAEU35_RS08340 | - | 1683881..1684534 (+) | 654 | WP_317141366.1 | DUF1642 domain-containing protein | - |
| AAEU35_RS08345 | - | 1684531..1684668 (+) | 138 | Protein_1596 | aminotransferase | - |
| AAEU35_RS08350 | - | 1684682..1684960 (+) | 279 | WP_216793439.1 | hypothetical protein | - |
| AAEU35_RS08355 | - | 1684953..1685153 (+) | 201 | WP_216793441.1 | hypothetical protein | - |
| AAEU35_RS08360 | - | 1685165..1685509 (+) | 345 | WP_317141365.1 | hypothetical protein | - |
| AAEU35_RS08365 | - | 1685543..1685881 (-) | 339 | WP_317141364.1 | winged helix-turn-helix domain-containing protein | - |
| AAEU35_RS08370 | - | 1686009..1686239 (+) | 231 | WP_317141363.1 | hypothetical protein | - |
| AAEU35_RS08375 | - | 1686245..1686394 (+) | 150 | WP_342630385.1 | DUF1660 family phage protein | - |
| AAEU35_RS08380 | - | 1686455..1686622 (+) | 168 | WP_201179682.1 | hypothetical protein | - |
| AAEU35_RS08385 | - | 1686935..1687066 (-) | 132 | WP_165379799.1 | MucR family transcriptional regulator | - |
| AAEU35_RS08390 | - | 1687194..1687496 (+) | 303 | WP_317141361.1 | hypothetical protein | - |
| AAEU35_RS08395 | - | 1687497..1687700 (+) | 204 | WP_270329675.1 | hypothetical protein | - |
| AAEU35_RS08400 | - | 1687779..1688168 (+) | 390 | WP_317141360.1 | DUF722 domain-containing protein | - |
| AAEU35_RS08405 | - | 1688601..1688810 (+) | 210 | Protein_1608 | HNH endonuclease | - |
| AAEU35_RS08410 | - | 1688928..1689149 (+) | 222 | Protein_1609 | helix-turn-helix domain-containing protein | - |
| AAEU35_RS08415 | terL | 1689130..1690581 (+) | 1452 | WP_317141359.1 | phage terminase large subunit | - |
| AAEU35_RS08420 | - | 1690594..1692123 (+) | 1530 | WP_317141358.1 | phage portal protein | - |
| AAEU35_RS08425 | - | 1692116..1692946 (+) | 831 | WP_317141357.1 | phage minor head protein | - |
| AAEU35_RS08430 | - | 1692962..1694023 (+) | 1062 | WP_317141356.1 | XkdF-like putative serine protease domain-containing protein | - |
| AAEU35_RS08435 | - | 1694038..1694955 (+) | 918 | WP_317141355.1 | phage capsid protein | - |
| AAEU35_RS08440 | - | 1694984..1695217 (+) | 234 | WP_153927504.1 | Ig-like domain-containing protein | - |
| AAEU35_RS08445 | - | 1695274..1695675 (+) | 402 | WP_317141354.1 | hypothetical protein | - |
| AAEU35_RS08450 | - | 1695665..1696009 (+) | 345 | WP_003131319.1 | putative minor capsid protein | - |
| AAEU35_RS08455 | - | 1696006..1696335 (+) | 330 | WP_317141353.1 | hypothetical protein | - |
| AAEU35_RS08460 | - | 1696335..1696769 (+) | 435 | WP_317141352.1 | minor capsid protein | - |
| AAEU35_RS08465 | - | 1696782..1697261 (+) | 480 | WP_256294074.1 | hypothetical protein | - |
| AAEU35_RS08470 | - | 1697318..1697725 (+) | 408 | WP_029344314.1 | hypothetical protein | - |
| AAEU35_RS08475 | - | 1697741..1698448 (+) | 708 | WP_317141351.1 | Gp15 family bacteriophage protein | - |
| AAEU35_RS08480 | - | 1698438..1701041 (+) | 2604 | WP_317141350.1 | phage tail tape measure protein | - |
| AAEU35_RS08485 | - | 1701055..1702578 (+) | 1524 | WP_317141349.1 | distal tail protein Dit | - |
| AAEU35_RS08490 | - | 1702578..1704365 (+) | 1788 | WP_317141348.1 | hypothetical protein | - |
| AAEU35_RS08495 | - | 1704381..1705502 (+) | 1122 | WP_317141347.1 | hypothetical protein | - |
| AAEU35_RS08500 | - | 1705502..1705675 (+) | 174 | WP_096819001.1 | hypothetical protein | - |
| AAEU35_RS08505 | - | 1705695..1706144 (+) | 450 | Protein_1628 | hypothetical protein | - |
| AAEU35_RS08510 | - | 1706989..1707225 (+) | 237 | WP_317141346.1 | hypothetical protein | - |
| AAEU35_RS08515 | - | 1707238..1707462 (+) | 225 | WP_010905920.1 | hemolysin XhlA family protein | - |
| AAEU35_RS08520 | - | 1707476..1707763 (+) | 288 | WP_317141345.1 | phage holin | - |
| AAEU35_RS08525 | - | 1707763..1708542 (+) | 780 | WP_317141344.1 | peptidoglycan amidohydrolase family protein | - |
| AAEU35_RS08530 | - | 1708552..1708677 (+) | 126 | WP_317141343.1 | hypothetical protein | - |
| AAEU35_RS08535 | comGC | 1708839..1709135 (+) | 297 | WP_167593410.1 | competence type IV pilus major pilin ComGC | Machinery gene |
| AAEU35_RS08540 | comGD | 1709167..1709526 (+) | 360 | WP_023188582.1 | competence type IV pilus minor pilin ComGD | Machinery gene |
| AAEU35_RS08545 | comGE | 1709498..1709794 (+) | 297 | WP_058223572.1 | competence type IV pilus minor pilin ComGE | Machinery gene |
| AAEU35_RS08550 | comGF | 1709757..1710203 (+) | 447 | WP_029344525.1 | competence type IV pilus minor pilin ComGF | Machinery gene |
| AAEU35_RS08555 | comGG | 1710242..1710526 (+) | 285 | WP_025017139.1 | competence type IV pilus minor pilin ComGG | Machinery gene |
| AAEU35_RS08560 | - | 1710608..1711045 (+) | 438 | WP_003129992.1 | zinc-dependent MarR family transcriptional regulator | - |
| AAEU35_RS08565 | - | 1711042..1711884 (+) | 843 | WP_015427160.1 | metal ABC transporter substrate-binding protein | - |
| AAEU35_RS08570 | - | 1712061..1712798 (+) | 738 | WP_012898617.1 | metal ABC transporter ATP-binding protein | - |
| AAEU35_RS08575 | - | 1712791..1713600 (+) | 810 | WP_014570791.1 | metal ABC transporter permease | - |
| AAEU35_RS08580 | - | 1713638..1714504 (-) | 867 | WP_058204413.1 | RluA family pseudouridine synthase | - |
| AAEU35_RS08585 | - | 1714708..1715085 (+) | 378 | WP_180259833.1 | pyridoxamine 5'-phosphate oxidase family protein | - |
| AAEU35_RS08590 | - | 1715199..1715630 (+) | 432 | WP_010906308.1 | DUF3290 domain-containing protein | - |
| AAEU35_RS08595 | - | 1715647..1716282 (+) | 636 | WP_012898614.1 | DUF421 domain-containing protein | - |
| AAEU35_RS08600 | - | 1716591..1718822 (+) | 2232 | WP_003129980.1 | PBP1A family penicillin-binding protein | - |
| AAEU35_RS08605 | - | 1718924..1720741 (+) | 1818 | WP_039116455.1 | acyltransferase family protein | - |
Sequence
Protein
Download Length: 98 a.a. Molecular weight: 11104.02 Da Isoelectric Point: 7.2037
>NTDB_id=988191 AAEU35_RS08545 WP_058223572.1 1709498..1709794(+) (comGE) [Lactococcus lactis strain Q13]
MENLKRKSVKAYLLLESLISIALLAFLVSFIVSSLVQVRQKDTEENQKIEALNVAQMAIESHLKELSINGSDIKIKENQN
LLIISNHGKEIMRLELQS
MENLKRKSVKAYLLLESLISIALLAFLVSFIVSSLVQVRQKDTEENQKIEALNVAQMAIESHLKELSINGSDIKIKENQN
LLIISNHGKEIMRLELQS
Nucleotide
Download Length: 297 bp
>NTDB_id=988191 AAEU35_RS08545 WP_058223572.1 1709498..1709794(+) (comGE) [Lactococcus lactis strain Q13]
GTGGAAAATTTAAAAAGAAAATCAGTTAAGGCATATTTGCTTTTGGAAAGTTTAATTAGTATAGCTCTACTCGCTTTTCT
AGTCAGCTTTATCGTAAGTTCTCTTGTGCAAGTAAGACAAAAAGATACGGAAGAAAATCAAAAGATTGAAGCTTTAAACG
TGGCACAAATGGCGATTGAAAGTCACTTAAAAGAATTATCAATCAACGGTTCTGATATAAAGATAAAAGAAAACCAAAAT
TTACTGATTATTAGTAATCATGGAAAGGAAATTATGCGACTTGAACTTCAAAGTTAA
GTGGAAAATTTAAAAAGAAAATCAGTTAAGGCATATTTGCTTTTGGAAAGTTTAATTAGTATAGCTCTACTCGCTTTTCT
AGTCAGCTTTATCGTAAGTTCTCTTGTGCAAGTAAGACAAAAAGATACGGAAGAAAATCAAAAGATTGAAGCTTTAAACG
TGGCACAAATGGCGATTGAAAGTCACTTAAAAGAATTATCAATCAACGGTTCTGATATAAAGATAAAAGAAAACCAAAAT
TTACTGATTATTAGTAATCATGGAAAGGAAATTATGCGACTTGAACTTCAAAGTTAA
3D structure
| Source | ID | Structure |
|---|
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| comGE | Lactococcus lactis subsp. cremoris KW2 |
67.01 |
98.98 |
0.663 |