Detailed information    

insolico Bioinformatically predicted

Overview


Name   comGE   Type   Machinery gene
Locus tag   AAEU35_RS08545 Genome accession   NZ_CP152294
Coordinates   1709498..1709794 (+) Length   98 a.a.
NCBI ID   WP_058223572.1    Uniprot ID   -
Organism   Lactococcus lactis strain Q13     
Function   dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology)   
DNA binding and uptake

Related MGE


Note: This gene co-localizes with putative mobile genetic elements (MGEs) in the genome predicted by VRprofile2, as detailed below.

Gene-MGE association summary

MGE type MGE coordinates Gene coordinates Relative position Distance (bp)
Prophage 1672790..1720741 1709498..1709794 within 0


Gene organization within MGE regions


Location: 1672790..1720741
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  AAEU35_RS08245 - 1673823..1673963 (+) 141 WP_228777719.1 hypothetical protein -
  AAEU35_RS08250 - 1673960..1675417 (-) 1458 WP_311929689.1 recombinase family protein -
  AAEU35_RS08255 - 1675543..1676082 (-) 540 WP_023164651.1 PH domain-containing protein -
  AAEU35_RS08260 - 1676137..1676721 (-) 585 WP_288625240.1 hypothetical protein -
  AAEU35_RS08265 - 1676732..1677154 (-) 423 WP_317141376.1 helix-turn-helix transcriptional regulator -
  AAEU35_RS08270 - 1677310..1677531 (+) 222 WP_317141375.1 helix-turn-helix transcriptional regulator -
  AAEU35_RS08275 - 1677577..1678293 (+) 717 WP_317141374.1 phage antirepressor KilAC domain-containing protein -
  AAEU35_RS08280 - 1678309..1678491 (+) 183 WP_003130605.1 hypothetical protein -
  AAEU35_RS08285 - 1678488..1678610 (+) 123 WP_023164646.1 hypothetical protein -
  AAEU35_RS08290 - 1678623..1678808 (+) 186 WP_038600407.1 hypothetical protein -
  AAEU35_RS08295 - 1678840..1679013 (+) 174 WP_014573167.1 putative transcriptional regulator -
  AAEU35_RS08300 - 1679114..1679980 (+) 867 WP_317141373.1 recombinase RecT -
  AAEU35_RS08305 - 1679982..1680998 (+) 1017 WP_317141372.1 DUF1351 domain-containing protein -
  AAEU35_RS08310 - 1681273..1682196 (+) 924 WP_317141371.1 phage replisome organizer N-terminal domain-containing protein -
  AAEU35_RS08315 - 1682189..1682431 (+) 243 WP_317141370.1 hypothetical protein -
  AAEU35_RS08320 - 1682440..1682859 (+) 420 WP_317141369.1 RusA family crossover junction endodeoxyribonuclease -
  AAEU35_RS08325 - 1682967..1683173 (+) 207 WP_014570535.1 hypothetical protein -
  AAEU35_RS08330 - 1683182..1683598 (+) 417 WP_317141368.1 YopX family protein -
  AAEU35_RS08335 - 1683595..1683888 (+) 294 WP_317141367.1 hypothetical protein -
  AAEU35_RS08340 - 1683881..1684534 (+) 654 WP_317141366.1 DUF1642 domain-containing protein -
  AAEU35_RS08345 - 1684531..1684668 (+) 138 Protein_1596 aminotransferase -
  AAEU35_RS08350 - 1684682..1684960 (+) 279 WP_216793439.1 hypothetical protein -
  AAEU35_RS08355 - 1684953..1685153 (+) 201 WP_216793441.1 hypothetical protein -
  AAEU35_RS08360 - 1685165..1685509 (+) 345 WP_317141365.1 hypothetical protein -
  AAEU35_RS08365 - 1685543..1685881 (-) 339 WP_317141364.1 winged helix-turn-helix domain-containing protein -
  AAEU35_RS08370 - 1686009..1686239 (+) 231 WP_317141363.1 hypothetical protein -
  AAEU35_RS08375 - 1686245..1686394 (+) 150 WP_342630385.1 DUF1660 family phage protein -
  AAEU35_RS08380 - 1686455..1686622 (+) 168 WP_201179682.1 hypothetical protein -
  AAEU35_RS08385 - 1686935..1687066 (-) 132 WP_165379799.1 MucR family transcriptional regulator -
  AAEU35_RS08390 - 1687194..1687496 (+) 303 WP_317141361.1 hypothetical protein -
  AAEU35_RS08395 - 1687497..1687700 (+) 204 WP_270329675.1 hypothetical protein -
  AAEU35_RS08400 - 1687779..1688168 (+) 390 WP_317141360.1 DUF722 domain-containing protein -
  AAEU35_RS08405 - 1688601..1688810 (+) 210 Protein_1608 HNH endonuclease -
  AAEU35_RS08410 - 1688928..1689149 (+) 222 Protein_1609 helix-turn-helix domain-containing protein -
  AAEU35_RS08415 terL 1689130..1690581 (+) 1452 WP_317141359.1 phage terminase large subunit -
  AAEU35_RS08420 - 1690594..1692123 (+) 1530 WP_317141358.1 phage portal protein -
  AAEU35_RS08425 - 1692116..1692946 (+) 831 WP_317141357.1 phage minor head protein -
  AAEU35_RS08430 - 1692962..1694023 (+) 1062 WP_317141356.1 XkdF-like putative serine protease domain-containing protein -
  AAEU35_RS08435 - 1694038..1694955 (+) 918 WP_317141355.1 phage capsid protein -
  AAEU35_RS08440 - 1694984..1695217 (+) 234 WP_153927504.1 Ig-like domain-containing protein -
  AAEU35_RS08445 - 1695274..1695675 (+) 402 WP_317141354.1 hypothetical protein -
  AAEU35_RS08450 - 1695665..1696009 (+) 345 WP_003131319.1 putative minor capsid protein -
  AAEU35_RS08455 - 1696006..1696335 (+) 330 WP_317141353.1 hypothetical protein -
  AAEU35_RS08460 - 1696335..1696769 (+) 435 WP_317141352.1 minor capsid protein -
  AAEU35_RS08465 - 1696782..1697261 (+) 480 WP_256294074.1 hypothetical protein -
  AAEU35_RS08470 - 1697318..1697725 (+) 408 WP_029344314.1 hypothetical protein -
  AAEU35_RS08475 - 1697741..1698448 (+) 708 WP_317141351.1 Gp15 family bacteriophage protein -
  AAEU35_RS08480 - 1698438..1701041 (+) 2604 WP_317141350.1 phage tail tape measure protein -
  AAEU35_RS08485 - 1701055..1702578 (+) 1524 WP_317141349.1 distal tail protein Dit -
  AAEU35_RS08490 - 1702578..1704365 (+) 1788 WP_317141348.1 hypothetical protein -
  AAEU35_RS08495 - 1704381..1705502 (+) 1122 WP_317141347.1 hypothetical protein -
  AAEU35_RS08500 - 1705502..1705675 (+) 174 WP_096819001.1 hypothetical protein -
  AAEU35_RS08505 - 1705695..1706144 (+) 450 Protein_1628 hypothetical protein -
  AAEU35_RS08510 - 1706989..1707225 (+) 237 WP_317141346.1 hypothetical protein -
  AAEU35_RS08515 - 1707238..1707462 (+) 225 WP_010905920.1 hemolysin XhlA family protein -
  AAEU35_RS08520 - 1707476..1707763 (+) 288 WP_317141345.1 phage holin -
  AAEU35_RS08525 - 1707763..1708542 (+) 780 WP_317141344.1 peptidoglycan amidohydrolase family protein -
  AAEU35_RS08530 - 1708552..1708677 (+) 126 WP_317141343.1 hypothetical protein -
  AAEU35_RS08535 comGC 1708839..1709135 (+) 297 WP_167593410.1 competence type IV pilus major pilin ComGC Machinery gene
  AAEU35_RS08540 comGD 1709167..1709526 (+) 360 WP_023188582.1 competence type IV pilus minor pilin ComGD Machinery gene
  AAEU35_RS08545 comGE 1709498..1709794 (+) 297 WP_058223572.1 competence type IV pilus minor pilin ComGE Machinery gene
  AAEU35_RS08550 comGF 1709757..1710203 (+) 447 WP_029344525.1 competence type IV pilus minor pilin ComGF Machinery gene
  AAEU35_RS08555 comGG 1710242..1710526 (+) 285 WP_025017139.1 competence type IV pilus minor pilin ComGG Machinery gene
  AAEU35_RS08560 - 1710608..1711045 (+) 438 WP_003129992.1 zinc-dependent MarR family transcriptional regulator -
  AAEU35_RS08565 - 1711042..1711884 (+) 843 WP_015427160.1 metal ABC transporter substrate-binding protein -
  AAEU35_RS08570 - 1712061..1712798 (+) 738 WP_012898617.1 metal ABC transporter ATP-binding protein -
  AAEU35_RS08575 - 1712791..1713600 (+) 810 WP_014570791.1 metal ABC transporter permease -
  AAEU35_RS08580 - 1713638..1714504 (-) 867 WP_058204413.1 RluA family pseudouridine synthase -
  AAEU35_RS08585 - 1714708..1715085 (+) 378 WP_180259833.1 pyridoxamine 5'-phosphate oxidase family protein -
  AAEU35_RS08590 - 1715199..1715630 (+) 432 WP_010906308.1 DUF3290 domain-containing protein -
  AAEU35_RS08595 - 1715647..1716282 (+) 636 WP_012898614.1 DUF421 domain-containing protein -
  AAEU35_RS08600 - 1716591..1718822 (+) 2232 WP_003129980.1 PBP1A family penicillin-binding protein -
  AAEU35_RS08605 - 1718924..1720741 (+) 1818 WP_039116455.1 acyltransferase family protein -

Sequence


Protein


Download         Length: 98 a.a.        Molecular weight: 11104.02 Da        Isoelectric Point: 7.2037

>NTDB_id=988191 AAEU35_RS08545 WP_058223572.1 1709498..1709794(+) (comGE) [Lactococcus lactis strain Q13]
MENLKRKSVKAYLLLESLISIALLAFLVSFIVSSLVQVRQKDTEENQKIEALNVAQMAIESHLKELSINGSDIKIKENQN
LLIISNHGKEIMRLELQS

Nucleotide


Download         Length: 297 bp        

>NTDB_id=988191 AAEU35_RS08545 WP_058223572.1 1709498..1709794(+) (comGE) [Lactococcus lactis strain Q13]
GTGGAAAATTTAAAAAGAAAATCAGTTAAGGCATATTTGCTTTTGGAAAGTTTAATTAGTATAGCTCTACTCGCTTTTCT
AGTCAGCTTTATCGTAAGTTCTCTTGTGCAAGTAAGACAAAAAGATACGGAAGAAAATCAAAAGATTGAAGCTTTAAACG
TGGCACAAATGGCGATTGAAAGTCACTTAAAAGAATTATCAATCAACGGTTCTGATATAAAGATAAAAGAAAACCAAAAT
TTACTGATTATTAGTAATCATGGAAAGGAAATTATGCGACTTGAACTTCAAAGTTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  comGE Lactococcus lactis subsp. cremoris KW2

67.01

98.98

0.663


Multiple sequence alignment