NTDB

Overview

Name	comGE/cglE	Type	Machinery gene
Locus tag	U0450_RS06300	Genome accession	NZ_CP139863
Coordinates	1260078..1260380 (+)	Length	100 a.a.
NCBI ID	WP_226372546.1	Uniprot ID	-
Organism	Streptococcus pneumoniae strain 15P2112
Function	dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology) DNA binding and uptake

Genomic Context

Location: 1255078..1265380

Locus tag	Gene name	Coordinates (strand)	Size (bp)	Protein ID	Product	Description
U0450_RS06270	-	1255835..1256893 (+)	1059	WP_000649468.1	zinc-dependent alcohol dehydrogenase family protein	-
U0450_RS06275	-	1257044..1257409 (+)	366	WP_050212688.1	DUF1033 family protein	-
U0450_RS06280	comGA/cglA/cilD	1257485..1258426 (+)	942	WP_000249571.1	competence type IV pilus ATPase ComGA	Machinery gene
U0450_RS06285	comGB/cglB	1258374..1259390 (+)	1017	WP_078134945.1	competence type IV pilus assembly protein ComGB	Machinery gene
U0450_RS06290	comGC/cglC	1259392..1259718 (+)	327	WP_000738636.1	comG operon protein ComGC	Machinery gene
U0450_RS06295	comGD/cglD	1259711..1260115 (+)	405	WP_000588013.1	competence type IV pilus minor pilin ComGD	Machinery gene
U0450_RS06300	comGE/cglE	1260078..1260380 (+)	303	WP_226372546.1	competence type IV pilus minor pilin ComGE	Machinery gene
U0450_RS06305	comGF/cglF	1260343..1260804 (+)	462	WP_000250542.1	competence type IV pilus minor pilin ComGF	Machinery gene
U0450_RS06310	comGG/cglG	1260782..1261195 (+)	414	WP_000265624.1	competence type IV pilus minor pilin ComGG	Machinery gene
U0450_RS06315	-	1261332..1261926 (+)	595	Protein_1232	class I SAM-dependent methyltransferase	-
U0450_RS06320	comYH	1261987..1262940 (+)	954	WP_050233486.1	class I SAM-dependent methyltransferase	Machinery gene
U0450_RS06325	-	1262991..1264181 (+)	1191	WP_050233485.1	acetate kinase	-
U0450_RS06330	-	1264182..1264313 (+)	132	WP_000768904.1	hypothetical protein	-
U0450_RS06335	rnpA	1264330..1264701 (+)	372	WP_000739246.1	ribonuclease P protein component	-

Sequence

Protein

Download Length: 100 a.a. Molecular weight: 11104.10 Da Isoelectric Point: 9.7273

                                >NTDB_id=911573 U0450_RS06300 WP_226372546.1 1260078..1260380(+) (comGE/cglE) [Streptococcus pneumoniae strain 15P2112]

MEKLNALRKQKIRAVILLEAVVALAIFASIAPLLLGQIQKNRQEEAKILQKEEVLRVAKMALQTGQNQVSINGVEIQVFS

SEKGLEVYHGSEQLLAIKEP

Nucleotide

Download Length: 303 bp

                                >NTDB_id=911573 U0450_RS06300 WP_226372546.1 1260078..1260380(+) (comGE/cglE) [Streptococcus pneumoniae strain 15P2112]

ATGGAAAAATTAAACGCATTAAGGAAACAAAAAATTAGGGCAGTGATTTTACTGGAAGCAGTAGTCGCTCTAGCTATCTT

TGCCAGCATTGCGCCCCTCCTTTTGGGACAAATTCAAAAAAATAGGCAAGAGGAAGCAAAAATCTTGCAAAAGGAAGAAG

TCTTGAGGGTAGCTAAGATGGCCCTGCAGACGGGGCAAAATCAGGTAAGCATCAACGGAGTTGAGATTCAGGTATTTTCT

AGTGAAAAAGGATTGGAGGTCTACCATGGTTCAGAACAGTTGTTGGCAATCAAAGAGCCATAA

Domains

Predicted by InterproScan.

Type II secretory pathway pseudopilin (ComGE)

(16-97)

Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.

3D structure

Source	ID	Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.

Visualization of predicted probability:

Similar proteins

Only experimentally validated proteins are listed.

Protein	Organism	Identities (%)	Coverage (%)	H_a-value
comGE/cglE	Streptococcus pneumoniae Rx1	99	100	0.99
comGE/cglE	Streptococcus pneumoniae D39	99	100	0.99
comGE/cglE	Streptococcus pneumoniae R6	99	100	0.99
comGE/cglE	Streptococcus pneumoniae TIGR4	99	100	0.99
comGE/cglE	Streptococcus mitis NCTC 12261	97	100	0.97
comGE/cglE	Streptococcus mitis SK321	97	100	0.97
comYE	Streptococcus mutans UA140	43.333	90	0.39
comYE	Streptococcus mutans UA159	43.333	90	0.39

Detailed information NTG0911573