Detailed information    

insolico Bioinformatically predicted

Overview

Name   comGE   Type   Machinery gene
Locus tag   LLUC310_RS11660 Genome accession   NZ_CP129094
Coordinates   2133705..2133941 (-) Length   78 a.a.
NCBI ID   WP_014573335.1    Uniprot ID   -
Organism   Lactococcus cremoris strain UC310     
Function   dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology)   
DNA binding and uptake

Related MGE

Note: This gene co-localizes with putative mobile genetic elements (MGEs) in the genome predicted by VRprofile2, as detailed below.

Gene-MGE association summary

MGE type MGE coordinates Gene coordinates Relative position Distance (bp)
ICE 2128434..2132894 2133705..2133941 flank 811


Gene organization within MGE regions


Location: 2128434..2133941
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  LLUC310_RS11630 (LLUC310_11710) - 2129900..2130709 (-) 810 WP_011677177.1 metal ABC transporter permease -
  LLUC310_RS11635 (LLUC310_11715) - 2130702..2131439 (-) 738 WP_011677178.1 metal ABC transporter ATP-binding protein -
  LLUC310_RS11640 (LLUC310_11720) - 2131618..2132460 (-) 843 WP_011677179.1 metal ABC transporter solute-binding protein, Zn/Mn family -
  LLUC310_RS11645 (LLUC310_11725) - 2132457..2132894 (-) 438 WP_011677180.1 zinc-dependent MarR family transcriptional regulator -
  LLUC310_RS11650 (LLUC310_11730) comGG 2132974..2133336 (-) 363 WP_282675947.1 hypothetical protein Machinery gene
  LLUC310_RS11655 (LLUC310_11735) comGF 2133296..2133742 (-) 447 WP_011836043.1 competence type IV pilus minor pilin ComGF Machinery gene
  LLUC310_RS11660 (LLUC310_11740) comGE 2133705..2133941 (-) 237 WP_014573335.1 competence type IV pilus minor pilin ComGE Machinery gene

Sequence

Protein


Download         Length: 78 a.a.        Molecular weight: 8700.94 Da        Isoelectric Point: 4.3885

>NTDB_id=850800 LLUC310_RS11660 WP_014573335.1 2133705..2133941(-) (comGE) [Lactococcus cremoris strain UC310]
MALLSFLVTFLLSALTNSRQQEVQENQQIESLNVAQMAIESQLMELSLNGSVIKIRQDSTATIISDHGKEILRLEAQN

Nucleotide


Download         Length: 237 bp        

>NTDB_id=850800 LLUC310_RS11660 WP_014573335.1 2133705..2133941(-) (comGE) [Lactococcus cremoris strain UC310]
ATGGCATTATTGAGCTTTTTGGTCACTTTTCTCTTAAGTGCTCTTACTAATTCTCGTCAGCAAGAGGTACAAGAAAATCA
ACAAATTGAGTCCTTAAATGTAGCTCAGATGGCAATAGAAAGTCAGCTGATGGAACTATCGTTAAATGGTTCTGTTATAA
AAATAAGACAAGATTCGACTGCAACCATTATTAGTGACCATGGAAAGGAAATTTTGCGACTTGAAGCTCAAAATTAG

Domains

Predicted by InterproScan.

Type II secretory pathway pseudopilin (ComGE)

(1-74)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  comGE Lactococcus lactis subsp. cremoris KW2

96.154

100

0.962