Detailed information
Overview
| Name | comGE | Type | Machinery gene |
| Locus tag | UC509_RS10535 | Genome accession | NC_019435 |
| Coordinates | 2074240..2074476 (-) | Length | 78 a.a. |
| NCBI ID | WP_014573335.1 | Uniprot ID | - |
| Organism | Lactococcus cremoris subsp. cremoris UC509.9 | ||
| Function | dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology) DNA binding and uptake |
||
Related MGE
Note: This gene co-localizes with putative mobile genetic elements (MGEs) in the genome predicted by VRprofile2, as detailed below.
Gene-MGE association summary
| MGE type | MGE coordinates | Gene coordinates | Relative position | Distance (bp) |
|---|---|---|---|---|
| ICE | 2068974..2073428 | 2074240..2074476 | flank | 812 |
Gene organization within MGE regions
Location: 2068974..2074476
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| UC509_RS10505 (uc509_2094) | - | 2070434..2071243 (-) | 810 | WP_011677177.1 | metal ABC transporter permease | - |
| UC509_RS10510 (uc509_2095) | - | 2071236..2071973 (-) | 738 | WP_015082929.1 | metal ABC transporter ATP-binding protein | - |
| UC509_RS10515 (uc509_2096) | - | 2072152..2072994 (-) | 843 | WP_011677179.1 | metal ABC transporter solute-binding protein, Zn/Mn family | - |
| UC509_RS10520 (uc509_2097) | - | 2072991..2073428 (-) | 438 | WP_011677180.1 | zinc-dependent MarR family transcriptional regulator | - |
| UC509_RS10525 (uc509_2098) | comGG | 2073508..2073807 (-) | 300 | WP_011677181.1 | competence type IV pilus minor pilin ComGG | Machinery gene |
| UC509_RS10530 (uc509_2099) | comGF | 2073831..2074256 (-) | 426 | WP_373467301.1 | competence type IV pilus minor pilin ComGF | Machinery gene |
| UC509_RS10535 (uc509_2100) | comGE | 2074240..2074476 (-) | 237 | WP_014573335.1 | competence type IV pilus minor pilin ComGE | Machinery gene |
Sequence
Protein
Download Length: 78 a.a. Molecular weight: 8700.94 Da Isoelectric Point: 4.3885
>NTDB_id=54481 UC509_RS10535 WP_014573335.1 2074240..2074476(-) (comGE) [Lactococcus cremoris subsp. cremoris UC509.9]
MALLSFLVTFLLSALTNSRQQEVQENQQIESLNVAQMAIESQLMELSLNGSVIKIRQDSTATIISDHGKEILRLEAQN
MALLSFLVTFLLSALTNSRQQEVQENQQIESLNVAQMAIESQLMELSLNGSVIKIRQDSTATIISDHGKEILRLEAQN
Nucleotide
Download Length: 237 bp
>NTDB_id=54481 UC509_RS10535 WP_014573335.1 2074240..2074476(-) (comGE) [Lactococcus cremoris subsp. cremoris UC509.9]
ATGGCATTATTGAGCTTTTTGGTCACTTTTCTCTTAAGTGCTCTTACTAATTCTCGTCAGCAAGAGGTACAAGAAAATCA
ACAAATTGAGTCCTTAAATGTAGCTCAGATGGCAATAGAAAGTCAGCTGATGGAACTATCGTTAAATGGTTCTGTTATAA
AAATAAGACAAGATTCGACTGCAACCATTATTAGTGACCATGGAAAGGAAATTTTGCGACTTGAAGCTCAAAATTAG
ATGGCATTATTGAGCTTTTTGGTCACTTTTCTCTTAAGTGCTCTTACTAATTCTCGTCAGCAAGAGGTACAAGAAAATCA
ACAAATTGAGTCCTTAAATGTAGCTCAGATGGCAATAGAAAGTCAGCTGATGGAACTATCGTTAAATGGTTCTGTTATAA
AAATAAGACAAGATTCGACTGCAACCATTATTAGTGACCATGGAAAGGAAATTTTGCGACTTGAAGCTCAAAATTAG
3D structure
| Source | ID | Structure |
|---|
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| comGE | Lactococcus lactis subsp. cremoris KW2 |
96.154 |
100 |
0.962 |