Detailed information
Overview
| Name | comGE | Type | Machinery gene |
| Locus tag | I6I21_RS07255 | Genome accession | NZ_CP065984 |
| Coordinates | 1440432..1440728 (+) | Length | 98 a.a. |
| NCBI ID | WP_010906316.1 | Uniprot ID | A0A3N6L9Y1 |
| Organism | Lactococcus lactis strain FDAARGOS_1064 | ||
| Function | dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology) DNA binding and uptake |
||
Related MGE
Note: This gene co-localizes with putative mobile genetic elements (MGEs) in the genome predicted by VRprofile2, as detailed below.
Gene-MGE association summary
| MGE type | MGE coordinates | Gene coordinates | Relative position | Distance (bp) |
|---|---|---|---|---|
| Prophage | 1397336..1447225 | 1440432..1440728 | within | 0 |
Gene organization within MGE regions
Location: 1397336..1447225
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| I6I21_RS06975 (I6I21_06975) | - | 1397396..1402312 (+) | 4917 | WP_014570825.1 | PolC-type DNA polymerase III | - |
| I6I21_RS06980 (I6I21_06980) | comGA | 1402432..1403371 (+) | 940 | Protein_1336 | competence type IV pilus ATPase ComGA | - |
| I6I21_RS06985 (I6I21_06985) | comGB | 1403265..1404338 (+) | 1074 | WP_014570824.1 | competence type IV pilus assembly protein ComGB | Machinery gene |
| I6I21_RS06990 (I6I21_06990) | - | 1404352..1404492 (+) | 141 | WP_228777719.1 | hypothetical protein | - |
| I6I21_RS06995 (I6I21_06995) | - | 1404489..1405946 (-) | 1458 | WP_014570823.1 | recombinase family protein | - |
| I6I21_RS07000 (I6I21_07000) | - | 1406072..1406611 (-) | 540 | WP_014570822.1 | PH domain-containing protein | - |
| I6I21_RS07005 (I6I21_07005) | - | 1406667..1407251 (-) | 585 | WP_014570821.1 | hypothetical protein | - |
| I6I21_RS07010 (I6I21_07010) | - | 1407262..1407672 (-) | 411 | WP_014570820.1 | helix-turn-helix domain-containing protein | - |
| I6I21_RS07015 (I6I21_07015) | - | 1407849..1408082 (+) | 234 | WP_014570819.1 | helix-turn-helix domain-containing protein | - |
| I6I21_RS07020 (I6I21_07020) | - | 1408141..1408830 (+) | 690 | WP_014570818.1 | Rha family transcriptional regulator | - |
| I6I21_RS07025 (I6I21_07025) | - | 1408846..1409028 (+) | 183 | WP_043991177.1 | hypothetical protein | - |
| I6I21_RS12830 | - | 1409025..1409147 (+) | 123 | WP_014570816.1 | hypothetical protein | - |
| I6I21_RS07030 (I6I21_07030) | - | 1409161..1409409 (+) | 249 | WP_014570815.1 | hypothetical protein | - |
| I6I21_RS07035 (I6I21_07035) | - | 1409512..1410345 (+) | 834 | WP_014570814.1 | hypothetical protein | - |
| I6I21_RS07040 (I6I21_07040) | - | 1410342..1411268 (+) | 927 | WP_014570813.1 | RecT family recombinase | - |
| I6I21_RS07045 (I6I21_07045) | - | 1411532..1412446 (+) | 915 | WP_014570812.1 | phage replisome organizer N-terminal domain-containing protein | - |
| I6I21_RS07050 (I6I21_07050) | - | 1412439..1412681 (+) | 243 | WP_014570811.1 | L-rhamnose isomerase | - |
| I6I21_RS07055 (I6I21_07055) | - | 1412694..1413104 (+) | 411 | WP_014570810.1 | hypothetical protein | - |
| I6I21_RS07060 (I6I21_07060) | - | 1413427..1413702 (+) | 276 | WP_014570536.1 | hypothetical protein | - |
| I6I21_RS07065 (I6I21_07065) | - | 1413714..1414103 (+) | 390 | WP_014570537.1 | hypothetical protein | - |
| I6I21_RS07070 (I6I21_07070) | - | 1414245..1414919 (+) | 675 | WP_014570539.1 | DUF1642 domain-containing protein | - |
| I6I21_RS07075 (I6I21_07075) | - | 1414916..1415335 (+) | 420 | WP_003129863.1 | dUTP diphosphatase | - |
| I6I21_RS07080 (I6I21_07080) | - | 1415339..1415683 (+) | 345 | WP_198493811.1 | hypothetical protein | - |
| I6I21_RS07085 (I6I21_07085) | - | 1415680..1415931 (+) | 252 | WP_014570807.1 | hypothetical protein | - |
| I6I21_RS07090 (I6I21_07090) | - | 1415954..1416115 (+) | 162 | WP_181407342.1 | hypothetical protein | - |
| I6I21_RS07095 (I6I21_07095) | - | 1416108..1416479 (+) | 372 | WP_014570805.1 | hypothetical protein | - |
| I6I21_RS07100 (I6I21_07100) | - | 1416482..1416805 (+) | 324 | WP_014570804.1 | DUF1140 family protein | - |
| I6I21_RS07105 (I6I21_07105) | - | 1416866..1417084 (+) | 219 | WP_014570803.1 | hypothetical protein | - |
| I6I21_RS07110 (I6I21_07110) | - | 1417081..1417275 (+) | 195 | WP_023349206.1 | DUF1660 domain-containing protein | - |
| I6I21_RS07115 (I6I21_07115) | - | 1417404..1417565 (+) | 162 | WP_003131301.1 | hypothetical protein | - |
| I6I21_RS07120 (I6I21_07120) | - | 1417643..1418065 (+) | 423 | WP_014570802.1 | RinA family protein | - |
| I6I21_RS07130 (I6I21_07130) | - | 1418542..1419699 (+) | 1158 | Protein_1366 | DNA modification methylase | - |
| I6I21_RS07135 (I6I21_07135) | - | 1419728..1420225 (+) | 498 | WP_014570801.1 | hypothetical protein | - |
| I6I21_RS07140 (I6I21_07140) | terL | 1420206..1421657 (+) | 1452 | WP_014570551.1 | phage terminase large subunit | - |
| I6I21_RS07145 (I6I21_07145) | - | 1421670..1423199 (+) | 1530 | WP_014570552.1 | phage portal protein | - |
| I6I21_RS07150 (I6I21_07150) | - | 1423192..1424022 (+) | 831 | WP_014570553.1 | phage minor head protein | - |
| I6I21_RS07155 (I6I21_07155) | - | 1424038..1425102 (+) | 1065 | WP_124156149.1 | XkdF-like putative serine protease domain-containing protein | - |
| I6I21_RS07160 (I6I21_07160) | - | 1425117..1426034 (+) | 918 | WP_003131315.1 | hypothetical protein | - |
| I6I21_RS07165 (I6I21_07165) | - | 1426063..1426299 (+) | 237 | WP_014570555.1 | Ig-like domain-containing protein | - |
| I6I21_RS07170 (I6I21_07170) | - | 1426373..1426774 (+) | 402 | WP_014570556.1 | hypothetical protein | - |
| I6I21_RS07175 (I6I21_07175) | - | 1426764..1427108 (+) | 345 | WP_014570557.1 | putative minor capsid protein | - |
| I6I21_RS07180 (I6I21_07180) | - | 1427105..1427434 (+) | 330 | WP_003131320.1 | hypothetical protein | - |
| I6I21_RS07185 (I6I21_07185) | - | 1427434..1427868 (+) | 435 | WP_014570558.1 | phage tail terminator protein | - |
| I6I21_RS07190 (I6I21_07190) | - | 1427879..1428355 (+) | 477 | WP_014570559.1 | phage tail tube protein | - |
| I6I21_RS07195 (I6I21_07195) | - | 1428412..1428819 (+) | 408 | WP_003131323.1 | hypothetical protein | - |
| I6I21_RS07200 (I6I21_07200) | - | 1428835..1429542 (+) | 708 | WP_014570560.1 | Gp15 family bacteriophage protein | - |
| I6I21_RS07205 (I6I21_07205) | - | 1429532..1431745 (+) | 2214 | WP_014570561.1 | phage tail tape measure protein | - |
| I6I21_RS07210 (I6I21_07210) | - | 1431755..1433284 (+) | 1530 | WP_014570562.1 | distal tail protein Dit | - |
| I6I21_RS07215 (I6I21_07215) | - | 1433263..1437348 (+) | 4086 | WP_193363677.1 | hypothetical protein | - |
| I6I21_RS07220 (I6I21_07220) | - | 1437360..1437596 (+) | 237 | WP_014570799.1 | hypothetical protein | - |
| I6I21_RS07225 (I6I21_07225) | - | 1437609..1437959 (+) | 351 | WP_014570798.1 | hypothetical protein | - |
| I6I21_RS07230 (I6I21_07230) | - | 1437972..1438271 (+) | 300 | WP_014570797.1 | phage holin | - |
| I6I21_RS07235 (I6I21_07235) | - | 1438271..1439050 (+) | 780 | WP_014570796.1 | peptidoglycan amidohydrolase family protein | - |
| I6I21_RS07240 (I6I21_07240) | - | 1439129..1439653 (+) | 525 | WP_014570795.1 | GNAT family N-acetyltransferase | - |
| I6I21_RS07245 (I6I21_07245) | comGC | 1439800..1440069 (+) | 270 | WP_003129998.1 | competence type IV pilus major pilin ComGC | Machinery gene |
| I6I21_RS07250 (I6I21_07250) | comGD | 1440029..1440460 (+) | 432 | WP_014570794.1 | competence type IV pilus minor pilin ComGD | Machinery gene |
| I6I21_RS07255 (I6I21_07255) | comGE | 1440432..1440728 (+) | 297 | WP_010906316.1 | competence type IV pilus minor pilin ComGE | Machinery gene |
| I6I21_RS07260 (I6I21_07260) | comGF | 1440691..1441137 (+) | 447 | WP_029344525.1 | competence type IV pilus minor pilin ComGF | Machinery gene |
| I6I21_RS07265 (I6I21_07265) | comGG | 1441176..1441460 (+) | 285 | WP_003129993.1 | competence type IV pilus minor pilin ComGG | Machinery gene |
| I6I21_RS07270 (I6I21_07270) | - | 1441550..1441987 (+) | 438 | WP_003129992.1 | zinc-dependent MarR family transcriptional regulator | - |
| I6I21_RS07275 (I6I21_07275) | - | 1441984..1442826 (+) | 843 | WP_003129990.1 | metal ABC transporter substrate-binding protein | - |
| I6I21_RS07280 (I6I21_07280) | - | 1443003..1443740 (+) | 738 | WP_003129989.1 | metal ABC transporter ATP-binding protein | - |
| I6I21_RS07285 (I6I21_07285) | - | 1443733..1444542 (+) | 810 | WP_014570791.1 | metal ABC transporter permease | - |
| I6I21_RS07290 (I6I21_07290) | - | 1444581..1445447 (-) | 867 | WP_003129984.1 | RluA family pseudouridine synthase | - |
| I6I21_RS07295 (I6I21_07295) | - | 1445651..1446028 (+) | 378 | WP_003129983.1 | pyridoxamine 5'-phosphate oxidase family protein | - |
| I6I21_RS07300 (I6I21_07300) | - | 1446142..1446573 (+) | 432 | WP_010906308.1 | DUF3290 domain-containing protein | - |
| I6I21_RS07305 (I6I21_07305) | - | 1446590..1447225 (+) | 636 | WP_012898614.1 | DUF421 domain-containing protein | - |
Sequence
Protein
Download Length: 98 a.a. Molecular weight: 11076.95 Da Isoelectric Point: 6.4684
>NTDB_id=515973 I6I21_RS07255 WP_010906316.1 1440432..1440728(+) (comGE) [Lactococcus lactis strain FDAARGOS_1064]
MENLKRKSVKAYLLLESLISIALLAFLVSFIVSSLVQVRQKDTEENQKIEALNVAQMAIESHLTELSINGSDIKIKENQN
LLIISNHGKEIMRLELQS
MENLKRKSVKAYLLLESLISIALLAFLVSFIVSSLVQVRQKDTEENQKIEALNVAQMAIESHLTELSINGSDIKIKENQN
LLIISNHGKEIMRLELQS
Nucleotide
Download Length: 297 bp
>NTDB_id=515973 I6I21_RS07255 WP_010906316.1 1440432..1440728(+) (comGE) [Lactococcus lactis strain FDAARGOS_1064]
GTGGAAAATTTAAAAAGAAAATCAGTTAAGGCATATTTGCTTTTGGAAAGTTTAATTAGTATAGCTCTACTCGCTTTTCT
AGTCAGCTTTATCGTAAGTTCTCTTGTGCAAGTAAGACAAAAAGATACGGAAGAAAATCAAAAGATTGAAGCTTTAAACG
TGGCACAAATGGCGATTGAAAGTCACTTAACAGAATTATCAATCAACGGTTCTGATATAAAGATAAAAGAAAACCAAAAT
TTACTGATTATTAGTAATCATGGAAAGGAAATTATGCGACTTGAACTTCAAAGTTAA
GTGGAAAATTTAAAAAGAAAATCAGTTAAGGCATATTTGCTTTTGGAAAGTTTAATTAGTATAGCTCTACTCGCTTTTCT
AGTCAGCTTTATCGTAAGTTCTCTTGTGCAAGTAAGACAAAAAGATACGGAAGAAAATCAAAAGATTGAAGCTTTAAACG
TGGCACAAATGGCGATTGAAAGTCACTTAACAGAATTATCAATCAACGGTTCTGATATAAAGATAAAAGAAAACCAAAAT
TTACTGATTATTAGTAATCATGGAAAGGAAATTATGCGACTTGAACTTCAAAGTTAA
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| comGE | Lactococcus lactis subsp. cremoris KW2 |
68.041 |
98.98 |
0.673 |