Detailed information    

insolico Bioinformatically predicted

Overview


Name   comGE   Type   Machinery gene
Locus tag   I6I21_RS07255 Genome accession   NZ_CP065984
Coordinates   1440432..1440728 (+) Length   98 a.a.
NCBI ID   WP_010906316.1    Uniprot ID   A0A3N6L9Y1
Organism   Lactococcus lactis strain FDAARGOS_1064     
Function   dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology)   
DNA binding and uptake

Related MGE


Note: This gene co-localizes with putative mobile genetic elements (MGEs) in the genome predicted by VRprofile2, as detailed below.

Gene-MGE association summary

MGE type MGE coordinates Gene coordinates Relative position Distance (bp)
Prophage 1397336..1447225 1440432..1440728 within 0


Gene organization within MGE regions


Location: 1397336..1447225
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  I6I21_RS06975 (I6I21_06975) - 1397396..1402312 (+) 4917 WP_014570825.1 PolC-type DNA polymerase III -
  I6I21_RS06980 (I6I21_06980) comGA 1402432..1403371 (+) 940 Protein_1336 competence type IV pilus ATPase ComGA -
  I6I21_RS06985 (I6I21_06985) comGB 1403265..1404338 (+) 1074 WP_014570824.1 competence type IV pilus assembly protein ComGB Machinery gene
  I6I21_RS06990 (I6I21_06990) - 1404352..1404492 (+) 141 WP_228777719.1 hypothetical protein -
  I6I21_RS06995 (I6I21_06995) - 1404489..1405946 (-) 1458 WP_014570823.1 recombinase family protein -
  I6I21_RS07000 (I6I21_07000) - 1406072..1406611 (-) 540 WP_014570822.1 PH domain-containing protein -
  I6I21_RS07005 (I6I21_07005) - 1406667..1407251 (-) 585 WP_014570821.1 hypothetical protein -
  I6I21_RS07010 (I6I21_07010) - 1407262..1407672 (-) 411 WP_014570820.1 helix-turn-helix domain-containing protein -
  I6I21_RS07015 (I6I21_07015) - 1407849..1408082 (+) 234 WP_014570819.1 helix-turn-helix domain-containing protein -
  I6I21_RS07020 (I6I21_07020) - 1408141..1408830 (+) 690 WP_014570818.1 Rha family transcriptional regulator -
  I6I21_RS07025 (I6I21_07025) - 1408846..1409028 (+) 183 WP_043991177.1 hypothetical protein -
  I6I21_RS12830 - 1409025..1409147 (+) 123 WP_014570816.1 hypothetical protein -
  I6I21_RS07030 (I6I21_07030) - 1409161..1409409 (+) 249 WP_014570815.1 hypothetical protein -
  I6I21_RS07035 (I6I21_07035) - 1409512..1410345 (+) 834 WP_014570814.1 hypothetical protein -
  I6I21_RS07040 (I6I21_07040) - 1410342..1411268 (+) 927 WP_014570813.1 RecT family recombinase -
  I6I21_RS07045 (I6I21_07045) - 1411532..1412446 (+) 915 WP_014570812.1 phage replisome organizer N-terminal domain-containing protein -
  I6I21_RS07050 (I6I21_07050) - 1412439..1412681 (+) 243 WP_014570811.1 L-rhamnose isomerase -
  I6I21_RS07055 (I6I21_07055) - 1412694..1413104 (+) 411 WP_014570810.1 hypothetical protein -
  I6I21_RS07060 (I6I21_07060) - 1413427..1413702 (+) 276 WP_014570536.1 hypothetical protein -
  I6I21_RS07065 (I6I21_07065) - 1413714..1414103 (+) 390 WP_014570537.1 hypothetical protein -
  I6I21_RS07070 (I6I21_07070) - 1414245..1414919 (+) 675 WP_014570539.1 DUF1642 domain-containing protein -
  I6I21_RS07075 (I6I21_07075) - 1414916..1415335 (+) 420 WP_003129863.1 dUTP diphosphatase -
  I6I21_RS07080 (I6I21_07080) - 1415339..1415683 (+) 345 WP_198493811.1 hypothetical protein -
  I6I21_RS07085 (I6I21_07085) - 1415680..1415931 (+) 252 WP_014570807.1 hypothetical protein -
  I6I21_RS07090 (I6I21_07090) - 1415954..1416115 (+) 162 WP_181407342.1 hypothetical protein -
  I6I21_RS07095 (I6I21_07095) - 1416108..1416479 (+) 372 WP_014570805.1 hypothetical protein -
  I6I21_RS07100 (I6I21_07100) - 1416482..1416805 (+) 324 WP_014570804.1 DUF1140 family protein -
  I6I21_RS07105 (I6I21_07105) - 1416866..1417084 (+) 219 WP_014570803.1 hypothetical protein -
  I6I21_RS07110 (I6I21_07110) - 1417081..1417275 (+) 195 WP_023349206.1 DUF1660 domain-containing protein -
  I6I21_RS07115 (I6I21_07115) - 1417404..1417565 (+) 162 WP_003131301.1 hypothetical protein -
  I6I21_RS07120 (I6I21_07120) - 1417643..1418065 (+) 423 WP_014570802.1 RinA family protein -
  I6I21_RS07130 (I6I21_07130) - 1418542..1419699 (+) 1158 Protein_1366 DNA modification methylase -
  I6I21_RS07135 (I6I21_07135) - 1419728..1420225 (+) 498 WP_014570801.1 hypothetical protein -
  I6I21_RS07140 (I6I21_07140) terL 1420206..1421657 (+) 1452 WP_014570551.1 phage terminase large subunit -
  I6I21_RS07145 (I6I21_07145) - 1421670..1423199 (+) 1530 WP_014570552.1 phage portal protein -
  I6I21_RS07150 (I6I21_07150) - 1423192..1424022 (+) 831 WP_014570553.1 phage minor head protein -
  I6I21_RS07155 (I6I21_07155) - 1424038..1425102 (+) 1065 WP_124156149.1 XkdF-like putative serine protease domain-containing protein -
  I6I21_RS07160 (I6I21_07160) - 1425117..1426034 (+) 918 WP_003131315.1 hypothetical protein -
  I6I21_RS07165 (I6I21_07165) - 1426063..1426299 (+) 237 WP_014570555.1 Ig-like domain-containing protein -
  I6I21_RS07170 (I6I21_07170) - 1426373..1426774 (+) 402 WP_014570556.1 hypothetical protein -
  I6I21_RS07175 (I6I21_07175) - 1426764..1427108 (+) 345 WP_014570557.1 putative minor capsid protein -
  I6I21_RS07180 (I6I21_07180) - 1427105..1427434 (+) 330 WP_003131320.1 hypothetical protein -
  I6I21_RS07185 (I6I21_07185) - 1427434..1427868 (+) 435 WP_014570558.1 phage tail terminator protein -
  I6I21_RS07190 (I6I21_07190) - 1427879..1428355 (+) 477 WP_014570559.1 phage tail tube protein -
  I6I21_RS07195 (I6I21_07195) - 1428412..1428819 (+) 408 WP_003131323.1 hypothetical protein -
  I6I21_RS07200 (I6I21_07200) - 1428835..1429542 (+) 708 WP_014570560.1 Gp15 family bacteriophage protein -
  I6I21_RS07205 (I6I21_07205) - 1429532..1431745 (+) 2214 WP_014570561.1 phage tail tape measure protein -
  I6I21_RS07210 (I6I21_07210) - 1431755..1433284 (+) 1530 WP_014570562.1 distal tail protein Dit -
  I6I21_RS07215 (I6I21_07215) - 1433263..1437348 (+) 4086 WP_193363677.1 hypothetical protein -
  I6I21_RS07220 (I6I21_07220) - 1437360..1437596 (+) 237 WP_014570799.1 hypothetical protein -
  I6I21_RS07225 (I6I21_07225) - 1437609..1437959 (+) 351 WP_014570798.1 hypothetical protein -
  I6I21_RS07230 (I6I21_07230) - 1437972..1438271 (+) 300 WP_014570797.1 phage holin -
  I6I21_RS07235 (I6I21_07235) - 1438271..1439050 (+) 780 WP_014570796.1 peptidoglycan amidohydrolase family protein -
  I6I21_RS07240 (I6I21_07240) - 1439129..1439653 (+) 525 WP_014570795.1 GNAT family N-acetyltransferase -
  I6I21_RS07245 (I6I21_07245) comGC 1439800..1440069 (+) 270 WP_003129998.1 competence type IV pilus major pilin ComGC Machinery gene
  I6I21_RS07250 (I6I21_07250) comGD 1440029..1440460 (+) 432 WP_014570794.1 competence type IV pilus minor pilin ComGD Machinery gene
  I6I21_RS07255 (I6I21_07255) comGE 1440432..1440728 (+) 297 WP_010906316.1 competence type IV pilus minor pilin ComGE Machinery gene
  I6I21_RS07260 (I6I21_07260) comGF 1440691..1441137 (+) 447 WP_029344525.1 competence type IV pilus minor pilin ComGF Machinery gene
  I6I21_RS07265 (I6I21_07265) comGG 1441176..1441460 (+) 285 WP_003129993.1 competence type IV pilus minor pilin ComGG Machinery gene
  I6I21_RS07270 (I6I21_07270) - 1441550..1441987 (+) 438 WP_003129992.1 zinc-dependent MarR family transcriptional regulator -
  I6I21_RS07275 (I6I21_07275) - 1441984..1442826 (+) 843 WP_003129990.1 metal ABC transporter substrate-binding protein -
  I6I21_RS07280 (I6I21_07280) - 1443003..1443740 (+) 738 WP_003129989.1 metal ABC transporter ATP-binding protein -
  I6I21_RS07285 (I6I21_07285) - 1443733..1444542 (+) 810 WP_014570791.1 metal ABC transporter permease -
  I6I21_RS07290 (I6I21_07290) - 1444581..1445447 (-) 867 WP_003129984.1 RluA family pseudouridine synthase -
  I6I21_RS07295 (I6I21_07295) - 1445651..1446028 (+) 378 WP_003129983.1 pyridoxamine 5'-phosphate oxidase family protein -
  I6I21_RS07300 (I6I21_07300) - 1446142..1446573 (+) 432 WP_010906308.1 DUF3290 domain-containing protein -
  I6I21_RS07305 (I6I21_07305) - 1446590..1447225 (+) 636 WP_012898614.1 DUF421 domain-containing protein -

Sequence


Protein


Download         Length: 98 a.a.        Molecular weight: 11076.95 Da        Isoelectric Point: 6.4684

>NTDB_id=515973 I6I21_RS07255 WP_010906316.1 1440432..1440728(+) (comGE) [Lactococcus lactis strain FDAARGOS_1064]
MENLKRKSVKAYLLLESLISIALLAFLVSFIVSSLVQVRQKDTEENQKIEALNVAQMAIESHLTELSINGSDIKIKENQN
LLIISNHGKEIMRLELQS

Nucleotide


Download         Length: 297 bp        

>NTDB_id=515973 I6I21_RS07255 WP_010906316.1 1440432..1440728(+) (comGE) [Lactococcus lactis strain FDAARGOS_1064]
GTGGAAAATTTAAAAAGAAAATCAGTTAAGGCATATTTGCTTTTGGAAAGTTTAATTAGTATAGCTCTACTCGCTTTTCT
AGTCAGCTTTATCGTAAGTTCTCTTGTGCAAGTAAGACAAAAAGATACGGAAGAAAATCAAAAGATTGAAGCTTTAAACG
TGGCACAAATGGCGATTGAAAGTCACTTAACAGAATTATCAATCAACGGTTCTGATATAAAGATAAAAGAAAACCAAAAT
TTACTGATTATTAGTAATCATGGAAAGGAAATTATGCGACTTGAACTTCAAAGTTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB A0A3N6L9Y1

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  comGE Lactococcus lactis subsp. cremoris KW2

68.041

98.98

0.673