Detailed information    

experimental Experimentally validated

Overview

Name   comS   Type   Regulator
Locus tag   - Genome accession   NC_012925
Coordinates   56396..56458 (+) Length   21 a.a.
NCBI ID   - Uniprot ID   -
Organism   Streptococcus suis P1/7     
Function   activate transcription of comX   
Competence regulation

Function

Induction of competence was dependent on ComX, a sigma factor that controls the streptococcal late competence regulon, extracellular addition of a comX-inducing peptide (XIP), and ComR, a regulator of comX. XIP was identified as an N-terminally truncated variant of ComS.


Genomic Context

Location: 51396..61458
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  SSU_RS10400 - 52321..52494 (+) 174 WP_011921669.1 hypothetical protein -
  SSU_RS00315 (SSU0046) ruvB 52789..53790 (+) 1002 WP_004195448.1 Holliday junction branch migration DNA helicase RuvB -
  SSU_RS00320 (SSU0047) - 53790..54536 (+) 747 WP_011921670.1 GNAT family N-acetyltransferase -
  SSU_RS00325 (SSU0048) - 54538..55173 (+) 636 WP_011921671.1 HAD-IA family hydrolase -
  SSU_RS00330 (SSU0049) comR 55420..56319 (+) 900 WP_012774888.1 helix-turn-helix domain-containing protein Regulator
  - comS 56396..56458 (+) 63 - - Regulator
  SSU_RS00335 (SSU0051) - 56724..57887 (+) 1164 WP_011921673.1 IS110 family transposase -
  SSU_RS00345 (SSU0053) - 58425..59363 (-) 939 WP_011921674.1 IS4 family transposase -
  SSU_RS00350 (SSU0054) - 59503..60723 (+) 1221 WP_012774890.1 bifunctional folylpolyglutamate synthase/dihydrofolate synthase -

Regulatory network

Positive effect      
Negative effect
Regulator Target Regulation
  comS comX/sigX positive effect
  comX/sigX late competence genes positive effect
  comX/sigX late competence genes positive effect
  comR comX/sigX positive effect

Sequence

Protein


Download         Length: 21 a.a.        Molecular weight: 2551.90 Da        Isoelectric Point: 5.9857

>NTDB_id=456 56396..56458(+) (comS) [Streptococcus suis P1/7]
MFNYLKFFGRLGGNWGTWVEE

Nucleotide


Download         Length: 63 bp        

>NTDB_id=456 56396..56458(+) (comS) [Streptococcus suis P1/7]
ATGTTTAACTATTTGAAATTTTTTGGTCGTCTTGGCGGTAACTGGGGAACATGGGTTGAAGAA

XIP

This gene is known to encode the precursor of σX inducing peptide (XIP), which involves in competence development. The mature XIP sequence is displayed as below:

WGTWVEE


Domains


No domain identified.



Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value

References

[1] Edoardo Zaccaria et al. (2014) Control of competence for DNA transformation in streptococcus suis by genetically transferable pherotypes. PloS One 9(6):e99394. [PMID: 24968201]