Detailed information    

insolico Bioinformatically predicted

Overview

Name   comGE   Type   Machinery gene
Locus tag   CV702_RS10875 Genome accession   NZ_CP024954
Coordinates   2244511..2244807 (-) Length   98 a.a.
NCBI ID   WP_017865157.1    Uniprot ID   -
Organism   Lactococcus lactis subsp. lactis strain F44     
Function   dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology)   
DNA binding and uptake

Genomic Context

Location: 2239511..2249807
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  CV702_RS10840 (CV702_10850) - 2240374..2240667 (+) 294 WP_226898169.1 pseudouridine synthase -
  CV702_RS10845 (CV702_10855) - 2240706..2241515 (-) 810 WP_014570791.1 metal ABC transporter permease -
  CV702_RS10850 (CV702_10860) - 2241508..2242245 (-) 738 WP_012898617.1 metal ABC transporter ATP-binding protein -
  CV702_RS10855 (CV702_10865) - 2242422..2243264 (-) 843 WP_017865154.1 metal ABC transporter substrate-binding protein -
  CV702_RS10860 (CV702_10870) - 2243261..2243698 (-) 438 WP_010906313.1 zinc-dependent MarR family transcriptional regulator -
  CV702_RS10865 (CV702_10875) comGG 2243779..2244063 (-) 285 WP_017865155.1 competence type IV pilus minor pilin ComGG Machinery gene
  CV702_RS10870 (CV702_10880) comGF 2244102..2244548 (-) 447 WP_032948129.1 competence type IV pilus minor pilin ComGF Machinery gene
  CV702_RS10875 (CV702_10885) comGE 2244511..2244807 (-) 297 WP_017865157.1 competence type IV pilus minor pilin ComGE Machinery gene
  CV702_RS10880 (CV702_10890) comGD 2244779..2245210 (-) 432 WP_026138965.1 competence type IV pilus minor pilin ComGD Machinery gene
  CV702_RS10885 (CV702_10895) comGC 2245170..2245505 (-) 336 WP_032948139.1 competence type IV pilus major pilin ComGC Machinery gene
  CV702_RS10890 (CV702_10900) comGB 2245567..2246640 (-) 1074 WP_080613278.1 competence type IV pilus assembly protein ComGB Machinery gene
  CV702_RS10895 (CV702_10905) comGA 2246534..2247472 (-) 939 WP_026138968.1 competence type IV pilus ATPase ComGA Machinery gene

Sequence

Protein


Download         Length: 98 a.a.        Molecular weight: 11082.91 Da        Isoelectric Point: 5.6957

>NTDB_id=256732 CV702_RS10875 WP_017865157.1 2244511..2244807(-) (comGE) [Lactococcus lactis subsp. lactis strain F44]
MENLKRKSVKAYLLLESLISIALLAFLVSFIVSSLVQVRQKDTEENQKIEALNVAQMAIESHLTELSINGSDIKIKENQN
FLIISNHGKEIMQLELQS

Nucleotide


Download         Length: 297 bp        

>NTDB_id=256732 CV702_RS10875 WP_017865157.1 2244511..2244807(-) (comGE) [Lactococcus lactis subsp. lactis strain F44]
GTGGAAAATTTAAAAAGAAAATCAGTTAAGGCATATTTGCTTTTGGAAAGTTTAATTAGTATAGCTCTACTCGCTTTTCT
AGTCAGCTTTATCGTAAGTTCTCTTGTGCAAGTAAGACAAAAAGATACGGAAGAAAATCAAAAGATTGAAGCTTTAAACG
TGGCACAAATGGCGATTGAAAGTCATTTAACAGAATTATCAATCAACGGTTCTGATATAAAGATAAAAGAAAACCAAAAT
TTTCTGATTATTAGTAATCATGGAAAGGAAATTATGCAACTTGAACTTCAAAGTTAA

Domains

Predicted by InterproScan.

Type II secretory pathway pseudopilin (ComGE)

(13-94)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  comGE Lactococcus lactis subsp. cremoris KW2

67.01

98.98

0.663

Multiple sequence alignment