Detailed information
Overview
| Name | pilB | Type | Machinery gene |
| Locus tag | XAC_RS16430 | Genome accession | NC_003919 |
| Coordinates | 3816632..3816751 (-) | Length | 39 a.a. |
| NCBI ID | WP_005915819.1 | Uniprot ID | A0A7S6YV99 |
| Organism | Xanthomonas citri pv. citri str. 306 | ||
| Function | power the assembly of type IV pilus (predicted from homology) DNA binding and uptake |
||
Related MGE
Note: This gene co-localizes with putative mobile genetic elements (MGEs) in the genome predicted by VRprofile2, as detailed below.
Gene-MGE association summary
| MGE type | MGE coordinates | Gene coordinates | Relative position | Distance (bp) |
|---|---|---|---|---|
| Genomic island | 3795904..3816403 | 3816632..3816751 | flank | 229 |
Gene organization within MGE regions
Location: 3795904..3816751
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| XAC_RS24040 (XAC3223) | - | 3795904..3797071 (+) | 1168 | Protein_3218 | IS3 family transposase | - |
| XAC_RS16350 (XAC3224) | avrXacE2 | 3797831..3798901 (-) | 1071 | WP_011052114.1 | type III secretion system effector avirulence protein AvrXacE2 | - |
| XAC_RS16355 (XAC3225) | - | 3798986..3800263 (-) | 1278 | WP_011052115.1 | lytic murein transglycosylase | - |
| XAC_RS16360 (XAC3226) | - | 3800396..3803386 (-) | 2991 | WP_040107658.1 | Tn3-like element TnXax1 family transposase | - |
| XAC_RS16365 (XAC3227) | - | 3803395..3804669 (-) | 1275 | Protein_3222 | site-specific integrase | - |
| XAC_RS16375 (XAC3229) | - | 3804862..3805938 (+) | 1077 | WP_011052118.1 | DNA-binding protein | - |
| XAC_RS16380 (XAC3230) | xopAI | 3806072..3806962 (+) | 891 | WP_011052119.1 | type III secretion system effector XopAI | - |
| XAC_RS16385 (XAC3231) | - | 3807382..3808188 (-) | 807 | WP_015463520.1 | hypothetical protein | - |
| XAC_RS16390 | - | 3808293..3808577 (+) | 285 | WP_016849322.1 | hypothetical protein | - |
| XAC_RS16395 (XAC3233) | - | 3808805..3809920 (+) | 1116 | WP_011052122.1 | IS1595 family transposase | - |
| XAC_RS16400 (XAC3234) | - | 3809875..3810390 (-) | 516 | WP_011052123.1 | hypothetical protein | - |
| XAC_RS16405 (XAC3235) | sucD | 3810477..3811352 (-) | 876 | WP_005921370.1 | succinate--CoA ligase subunit alpha | - |
| XAC_RS16410 (XAC3236) | sucC | 3811377..3812546 (-) | 1170 | WP_005915812.1 | ADP-forming succinate--CoA ligase subunit beta | - |
| XAC_RS16415 (XAC3237) | - | 3812778..3814391 (+) | 1614 | WP_003488599.1 | sensor histidine kinase | - |
| XAC_RS16420 (XAC3238) | pilR | 3814716..3816110 (+) | 1395 | WP_015463522.1 | sigma-54-dependent transcriptional regulator | Regulator |
| XAC_RS16425 | - | 3816333..3816500 (-) | 168 | WP_015463523.1 | hypothetical protein | - |
| XAC_RS16430 | pilB | 3816632..3816751 (-) | 120 | WP_005915819.1 | hypothetical protein | Machinery gene |
Sequence
Protein
Download Length: 39 a.a. Molecular weight: 4178.84 Da Isoelectric Point: 9.0113
>NTDB_id=22071 XAC_RS16430 WP_005915819.1 3816632..3816751(-) (pilB) [Xanthomonas citri pv. citri str. 306]
MQIAEAAQAIGIRDLRQSALMKAAHGVTSLAEINRVTKD
MQIAEAAQAIGIRDLRQSALMKAAHGVTSLAEINRVTKD
Nucleotide
Download Length: 120 bp
>NTDB_id=22071 XAC_RS16430 WP_005915819.1 3816632..3816751(-) (pilB) [Xanthomonas citri pv. citri str. 306]
ATGCAGATCGCCGAGGCCGCACAGGCGATCGGTATCCGCGATTTGCGGCAGTCGGCGTTGATGAAGGCTGCGCACGGGGT
GACCAGCCTGGCGGAGATCAATCGTGTGACGAAGGACTAA
ATGCAGATCGCCGAGGCCGCACAGGCGATCGGTATCCGCGATTTGCGGCAGTCGGCGTTGATGAAGGCTGCGCACGGGGT
GACCAGCCTGGCGGAGATCAATCGTGTGACGAAGGACTAA
Domains
No domain identified.
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| pilB | Acinetobacter baylyi ADP1 |
51.282 |
100 |
0.513 |
| pilB | Acinetobacter baumannii D1279779 |
48.718 |
100 |
0.487 |
| pilB | Vibrio cholerae strain A1552 |
45.714 |
89.744 |
0.41 |
| pilB | Legionella pneumophila strain ERS1305867 |
38.462 |
100 |
0.385 |