ICEberg
I. Information of IME
ICEberg ID242_IME
Name Tn4555 This IME is derived from experimental literature
Family-
OrganismBacteroides vulgatus CLA341
Size (bp)12105 bp
GC content [Genome] (%)
Insertion siteAT-rich regions
Function-lactamase gene cfxA
Species that IME can be transferred to-
Nucleotide SequenceU75371.3 (complete IME sequence in this GenBank file)
Replicon-
Coordinates1..12105
Putative oriT region coordinates: 6390..6563;   oriTDB id:  200008
ACGATTTAGACCTTGTGCTGGTCGGTGCATCTCCAATCGGCAACGATGATGAAAAACCTCCCTGACGGAG
GAGAGCGGAAGCCGTAGGCTGGAGTTTGCAGACAATGGCTTGCCATTGATATAGCCCACTATAACTACAC
GCTCCGCTTACGTAGTTGTGGGCTCTCCCGAGGG
Putative relaxase -


II. IME interaction with ICE/CIME/Plasmids

The Interaction Network among ICE/IME/CIME/plasmid


Detailed Informatioin of the Interaction Network
# IME  Inter_Ele [Type] Methods Donors Recipients Exper_Ref 
1Tn4555 CTn341 [ICE] experimentalin trans Bacteroides vulgatus Escherichia coli 14702313
2Tn4555 RK2 [IncP plasmid] experimentalin trans Escherichia coli Escherichia coli 8386723
3Tn4555 R751 [IncP plasmid] experimentalin trans Escherichia coli Escherichia coli 8386723

experimental This is an interactioin derived from experimental literature


The graph information of Tn4555 components from U75371
Complete gene list of Tn4555 from U75371
#GeneCoordinates [+/-], size (bp) Product *Reannotation 
1tnpA358..1293 [+], 936TnpA
2int1435..2553 [+], 1119integraseIntegrase 
3tnpC2801..3658 [+], 858TnpC
4xis3858..4232 [+], 375excisionase
5-4238..5335 [+], 1098unknown
6-5339..6454 [+], 1116unknown
7mobA6582..8141 [+], 1560mobilization protein
8cfxA8234..9199 [-], 966beta-lactamaseAR 
9-9372..10817 [+], 1446unknown
 
integrase Gene may contribute to site-specific recombination
virulence  Gene may be involved in adaptative function

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins9Fasta
(1) Guedon G; Libante V; Coluzzi C; Payot S; Leblond-Bourget N (2017). The Obscure World of Integrative and Mobilizable Elements, Highly Widespread Elements that Pirate Bacterial Conjugative Systems. Genes (Basel). 8(11). [PudMed:29165361]
(2) Bellanger X; Payot S; Leblond-Bourget N; Guedon G (2014). Conjugative and mobilizable genomic islands in bacteria: evolution and diversity. FEMS Microbiol Rev. 38(4):720-60. [PudMed:24372381]
(3) Ferreira LQ; Avelar KE; Vieira JM; de Paula GR; Colombo AP; Domingues RM; Ferreira MC (2007). Association between the cfxA gene and transposon Tn4555 in Bacteroides distasonis strains and other Bacteroides species. Curr Microbiol. 54(5):348-53. [PudMed:17486409]
(4) Bass KA; Hecht DW (2002). Isolation and characterization of cLV25, a Bacteroides fragilis chromosomal transfer factor resembling multiple Bacteroides sp. mobilizable transposons. J Bacteriol. 184(7):1895-904. [PudMed:11889096]
(5) Tribble GD; Parker AC; Smith CJ (1997). The Bacteroides mobilizable transposon Tn4555 integrates by a site-specific recombination mechanism similar to that of the gram-positive bacterial element Tn916. J Bacteriol. 179(8):2731-9. [PudMed:9098073]
(6) Smith CJ; Parker AC (1996). A gene product related to Tral is required for the mobilization of Bacteroides mobilizable transposons and plasmids. Mol Microbiol. 20(4):741-50. [PudMed:8793871]
(7) Smith CJ; Parker AC (1993). Identification of a circular intermediate in the transfer and transposition of Tn4555, a mobilizable transposon from Bacteroides spp. J Bacteriol. 175(9):2682-91. [PudMed:8386723]
 

Genomics & Bioinformatics Group in MML, SJTU