 ICEberg ID | 242_IME |
Name  | Tn4555  |
| Family | - |
| Organism | Bacteroides vulgatus CLA341 |
| Size (bp) | 12105 bp |
| GC content [Genome] (%) | |
| Insertion site | AT-rich regions |
| Function | -lactamase gene cfxA |
| Species that IME can be transferred to | - |
| Nucleotide Sequence | U75371.3 (complete IME sequence in this GenBank file) |
| Replicon | - |
| Coordinates | 1..12105 |
| Putative oriT region | coordinates: 6390..6563; oriTDB id: 200008 ACGATTTAGACCTTGTGCTGGTCGGTGCATCTCCAATCGGCAACGATGATGAAAAACCTCCCTGACGGAG GAGAGCGGAAGCCGTAGGCTGGAGTTTGCAGACAATGGCTTGCCATTGATATAGCCCACTATAACTACAC GCTCCGCTTACGTAGTTGTGGGCTCTCCCGAGGG |
| Putative relaxase | - |
The Interaction Network among ICE/IME/CIME/plasmid | ||||||
 | ||||||
| Detailed Informatioin of the Interaction Network | ||||||
| # | IME | Inter_Ele [Type] | Methods | Donors | Recipients | Exper_Ref |
| 1 | Tn4555 | CTn341 [ICE] | in trans | Bacteroides vulgatus | Escherichia coli | 14702313 |
| 2 | Tn4555 | RK2 [IncP plasmid] | in trans | Escherichia coli | Escherichia coli | 8386723 |
| 3 | Tn4555 | R751 [IncP plasmid] | in trans | Escherichia coli | Escherichia coli | 8386723 |
| This is an interactioin derived from experimental literature |
The graph information of Tn4555 components from U75371 | |||||
 | |||||
| Complete gene list of Tn4555 from U75371 | |||||
| # | Gene | Coordinates [+/-], size (bp) | Product | *Reannotation | |
| 1 | tnpA | 358..1293 [+], 936 | TnpA | ||
| 2 | int | 1435..2553 [+], 1119 | integrase | Integrase | |
| 3 | tnpC | 2801..3658 [+], 858 | TnpC | ||
| 4 | xis | 3858..4232 [+], 375 | excisionase | ||
| 5 | - | 4238..5335 [+], 1098 | unknown | ||
| 6 | - | 5339..6454 [+], 1116 | unknown | ||
| 7 | mobA | 6582..8141 [+], 1560 | mobilization protein | ||
| 8 | cfxA | 8234..9199 [-], 966 | beta-lactamase | AR | |
| 9 | - | 9372..10817 [+], 1446 | unknown | ||
 Gene may contribute to site-specific recombination |
 Gene may be involved in adaptative function |
| (1) Guedon G; Libante V; Coluzzi C; Payot S; Leblond-Bourget N (2017). The Obscure World of Integrative and Mobilizable Elements, Highly Widespread Elements that Pirate Bacterial Conjugative Systems. Genes (Basel). 8(11). [PudMed:29165361] |
| (2) Bellanger X; Payot S; Leblond-Bourget N; Guedon G (2014). Conjugative and mobilizable genomic islands in bacteria: evolution and diversity. FEMS Microbiol Rev. 38(4):720-60. [PudMed:24372381] |
| (3) Ferreira LQ; Avelar KE; Vieira JM; de Paula GR; Colombo AP; Domingues RM; Ferreira MC (2007). Association between the cfxA gene and transposon Tn4555 in Bacteroides distasonis strains and other Bacteroides species. Curr Microbiol. 54(5):348-53. [PudMed:17486409] |
| (4) Bass KA; Hecht DW (2002). Isolation and characterization of cLV25, a Bacteroides fragilis chromosomal transfer factor resembling multiple Bacteroides sp. mobilizable transposons. J Bacteriol. 184(7):1895-904. [PudMed:11889096] |
| (5) Tribble GD; Parker AC; Smith CJ (1997). The Bacteroides mobilizable transposon Tn4555 integrates by a site-specific recombination mechanism similar to that of the gram-positive bacterial element Tn916. J Bacteriol. 179(8):2731-9. [PudMed:9098073] |
| (6) Smith CJ; Parker AC (1996). A gene product related to Tral is required for the mobilization of Bacteroides mobilizable transposons and plasmids. Mol Microbiol. 20(4):741-50. [PudMed:8793871] |
| (7) Smith CJ; Parker AC (1993). Identification of a circular intermediate in the transfer and transposition of Tn4555, a mobilizable transposon from Bacteroides spp. J Bacteriol. 175(9):2682-91. [PudMed:8386723] |