CCCTCGGGAGAGCCCACAACTACGTAAGCGGAGCGTGTAGTTATAGTGGGCTATATCAAT
GGCAAGCCATTGTCTGCAAACTCCAGCCTACGGCTTCCGCTCTCCTCCGTCAGGGAGGTT
TTTCATCATCGTTGCCGATTGGAGATGCACCGACCAGCACAAGGTCTAAATCGT
[1] Tribble GD et al (1997) The Bacteroides mobilizable transposon Tn4555 integrates by a site-specific recombination mechanism similar to that of the gram-positive bacterial element Tn916. J Bacteriol. 179(8):2731-9. [PMID:9098073] |
[2] Vedantam G et al (2006) Bacteroides fragilis mobilizable transposon Tn5520 requires a 71 base pair origin of transfer sequence and a single mobilization protein for relaxosome formation during conjugation. Mol Microbiol. 59(1):288-300. [PMID:16359335] |
[3] Smith CJ et al (1998) The transfer origin for Bacteroides mobilizable transposon Tn4555 is related to a plasmid family from gram-positive bacteria. J Bacteriol. 180(2):435-9. [PMID:9440538] |
[4] Grohmann E et al (2003) Conjugative plasmid transfer in gram-positive bacteria. Microbiol Mol Biol Rev. 67(2):277-301. [PMID:12794193] |
[5] Grohmann E et al (1999) Mobilisation of the streptococcal plasmid pMV158: interactions of MobM protein with its cognate oriT DNA region. Mol Gen Genet. 261(4-5):707-15. [PMID:10394908] |