ICEberg
I. Information of ICE
ICEberg ID126
Name ICEKp1 This ICE is derived from experimental literature
ICEO ID ICEO_0000143
OrganismKlebsiella pneumoniae NTUH-K2044
Size (bp)75935
GC content [Genome] (%)52.18[57.68]
Insertion sitetRNA-asn(KP1_6086)
Function-
Species that ICE can be transferred toKlebsiella pneumoniae;Escherichia coli
Nucleotide SequenceAB298504; AP006725 (complete ICE sequence in this genome)
Replicon chromosome (5248520 bp, BioProject:21069) [NC_012731]
Genome coordinates3395836..3471770 
Putative oriT region coordinates: 3460564..3460687;   oriTDB id:  200013
CCGATTAGGCGCGACCAACCCCTTTAAAGCAGCGTTCCCATTTTTTCGAGCTTGCGAAGAAAAAATAGGC
TAAACGCGCGTCTTAAAGGGGTTGGTCGCGCGTAGCGGACGACGGTGTGCCGCC
Putative relaxase -


II. ICE interaction with IME/CIME/

The Interaction Network among ICE/IME/CIME


Detailed Informatioin of the Interaction Network
# ICE  Inter_Ele [Type] Methods Donors Recipients Exper_Ref 
1ICEKp1 GIE492 [IME] insolico- - - -

insolico This is a putative interactioin



The graph information of ICEKp1 components from AP006725
Complete gene list of ICEKp1 from AP006725
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)		 *Reannotation 
1KP1_35773390903..3391607 [-], 705putative TetR-family trancriptional regulatory protein
2KP1_35783392198..3393832 [+], 1635putative sodium:hydrogen antiporter
3yeeO3394131..3395600 [-], 1470putative MATE family transport protein
4int3395997..3397259 [+], 1263integraseIntegrase 
5ybtS3397453..3398757 [-], 1305putative salicylate synthetaseVF 
6ybtX3398785..3400188 [-], 1404putative cytoplasmic transmembrane proteinVF 
7ybtQ3400058..3401887 [-], 1830putative ABC transporter proteinVF 
8ybtP3401847..3403649 [-], 1803putative inner membrane ABC-transporterVF 
9ybtA3403816..3404775 [+], 960transcriptional regulatorVF 
10irp23404966..3411073 [+], 6108yersiniabactin biosynthetic proteinVF 
11irp13411161..3420652 [+], 9492yersiniabactin biosynthetic proteinVF 
12ybtU3420589..3421749 [+], 1161thiazolinyl-S-HMWP1 reductaseVF 
13ybtT3421746..3422549 [+], 804yersiniabactin biosynthetic proteinVF 
14ybtE3422553..3424130 [+], 1578yersiniabactin siderophore biosynthetic proteinVF 
15fyuA3424261..3426282 [+], 2022pesticin/yersiniabactin receptorVF 
16KP1_35953427155..3428081 [+], 927conserved hypothetical protein
17alpA23428221..3428406 [+], 186putative transcriptional regulator
18KP1_35973428595..3429176 [+], 582conserved hypothetical protein
19KP1_35993429618..3429731 [+], 114conserved hypothetical protein
20KP1_36003429775..3430386 [-], 612unnamed protein productTrbB, T4SS component 
21KP1_36013430310..3430501 [-], 192transposase/IS protein
22KP1_36023430528..3430620 [-], 93putative transposase
23KP1_36033430596..3431498 [-], 903putative transposase
24KP1_36043431686..3432066 [-], 381hypothetical protein
25vagC3432509..3432739 [+], 231virulence-associated protein
26vagD3432736..3433152 [+], 417putative DNA binding protein
27KP1_36073433170..3433433 [+], 264hypothetical protein
28iroN3433588..3435762 [-], 2175enterochelin and dihydrobenzoic acid receptorVF 
29iroB3436634..3437749 [+], 1116putative UDP-glucoronosyl and UDP-glucosyl transferaseVF 
30iroC3437836..3441531 [+], 3696putative ABC transporterVF 
31iroD3441637..3442866 [+], 1230ferric enterochelin esteraseVF 
32pagO3443871..3444785 [-], 915putative PhoPQ-activated integral membrane protein
33KP1_36163444858..3445409 [-], 552hypothetical protein
34KP1_36173445596..3445742 [+], 147hypothetical protein
35rmpA3445784..3446416 [-], 633regulator of mucoid phenotypeVF 
36KP1_36203446430..3446594 [+], 165hypothetical protein
37KP1_36213446958..3447611 [+], 654hypothetical protein
38KP1_36233447691..3447792 [-], 102putative transposase
39KP1_36243448249..3448434 [-], 186transposase/IS proteinTrbB, T4SS component 
40KP1_36253448919..3449152 [+], 234putative ATP/GTP-binding protein remnant
41virB13449225..3449935 [+], 711type IV secretory pathway VirB1 componentVirB1, T4SS component 
42virB23449935..3450228 [+], 294type IV secretory pathway VirB2 componentVirB2, T4SS component 
43virB3-43450241..3452979 [+], 2739type IV secretory pathway VirB3-4 componentVirB4, T4SS component 
44virB53452997..3453701 [+], 705type IV secretion system VirB5 componentVirB5, T4SS component 
45KP1_36303453711..3453938 [+], 228conserved hypothetical proteinMagB05, T4SS component 
46virB63453950..3455029 [+], 1080type IV secretion system VirB6 componentVirB6, T4SS component 
47virB83455245..3455928 [+], 684type IV secretion system VirB8 componentVirB8, T4SS component 
48virB93455925..3456833 [+], 909type IV secretory pathway VirB9 componentVirB9, T4SS component 
49virB103456877..3458127 [+], 1251type IV secretory pathway VirB10 componentVirB10, T4SS component 
50virB113458117..3459142 [+], 1026type IV secretory pathway VirB11 componentVirB11, T4SS component 
51KP1_36373459139..3459537 [+], 399hypothetical protein
52KP1_36383459573..3459875 [+], 303conserved hypothetical proteinMagB14, T4SS component 
53KP1_36393459918..3460223 [+], 306putative dopa decarboxylase protein remnant
54KP1_36403460334..3460636 [+], 303hypothetical protein
55mobB3460903..3462792 [+], 1890mobilization proteinVirD4, T4SS component 
56mobC3462802..3463548 [+], 747mobilization protein
57ardC3463744..3464691 [-], 948antirestriction protein
58KP1_36443465676..3466491 [-], 816hypothetical protein
59KP1_36453466792..3467139 [-], 348hypothetical protein
60KP1_36463467139..3468509 [-], 1371UBA/THIF-type NAD/FAD binding fold
61KP1_36473468506..3469633 [-], 1128hypothetical protein
62KP1_36483469728..3470276 [-], 549conserved hypothetical protein
63KP1_36493470319..3471422 [-], 1104hypothetical protein
64KP1_36503471621..3471770 [-], 150hypothetical protein
65KP1_36513472308..3473411 [+], 1104hypothetical protein
66KP1_36523473408..3474379 [-], 972hypothetical protein
67KP1_36533474586..3475563 [-], 978putative non-heme chloroperoxidase
68KP1_36543475615..3476190 [-], 576hypothetical protein
 
flank Flanking regions

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins61Fasta
(1) Wu KM; Li LH; Yan JJ; Tsao N; Liao TL; Tsai HC; Fung CP; Chen HJ; Liu YM; Wang JT; Fang CT; Chang SC; Shu HY; Liu TT; Chen YT; Shiau YR; Lauderdale TL; Su IJ; Kirby R; Tsai SF (2009). Genome sequencing and comparative analysis of Klebsiella pneumoniae NTUH-K2044, a strain causing liver abscess and meningitis. J Bacteriol. 191(14):4492-501. [PubMed:19447910]
(2) Lin TL; Lee CZ; Hsieh PF; Tsai SF; Wang JT (2008). Characterization of integrative and conjugative element ICEKp1-associated genomic heterogeneity in a Klebsiella pneumoniae strain isolated from a primary liver abscess. J Bacteriol. 190(2):515-26. [PubMed:17981959] experimental
 
experimental experimental literature

Genomics & Bioinformatics Group in MML, SJTU