 oriTDB accession number | 200013 |
| Name | oriT_ ICEKp1  |
Sequence Completeness  | intact |
| oriT length | 250 nt |
| oriT sequence | GCACACCGTCGCAGCCAGGCTATATTTCCCGCCCCGGCGGGGAATATGCCGATTAGGCGC GACCAACCCCTTTAAAGCAGCGTTCCCATTTTTTCGAGCTTGCGAAGAAAAAATAGGCTA AACGCGCGTCTTAAAGGGGTTGGTCGCGCGTAGCGGACGACGGTGTGCCGCCTTTGACCC TGGGGGTTTTGGCGTGGCGTCCAGCCGCGACATTACCCCCATGCACCGGGCAATAAGGGC GTCCAGCCCG |
| IR (inverted repeat) | [1-11] [158-168] nt (GCACACCGTCG.. CGACGGTGTGC) [57-75] [131-149] nt (GCGCGACCAACCCCTTTAA..TTAAAGGGGTTGGTCGCGC) |
| Location of nic site | [142-143] nt |
| Conserved sequence flanking the nic site | GGTTG|GTCGCG |
| Note | _ |
Visualization of oriT structure (The oriT was characterized experimentally) Reference| [1] Lin TL et al (2008) Characterization of integrative and conjugative element ICEKp1-associated genomic heterogeneity in a Klebsiella pneumoniae strain isolated from a primary liver abscess. J Bacteriol. 190(2):515-26. [PMID:17981959] |
| ID | 18 |
| Element type | high-pathogenicity island |
| ICE description | ICEKp1 |
| ICEberg accesion number | 126 |
| GenBank accession number | AB298504.1 |
| Family | ICEKp1 |
| Genome size | 75935 bp |
| Coordinate of oriT [+/-] | 66386..66635 [+] |
| Drug resistance | _ |
| Heavy-metal resistance | _ |
| Virulence factor |  high-pathogenicity island |
| Xenobiotic degradation | _ |
| Host bacterium [NCBI Taxonomy ID] | Klebsiella pneumoniae subsp. pneumoniae NTUH-K2044 [484021] |
Reference| [1] Lin TL et al (2008) Characterization of integrative and conjugative element ICEKp1-associated genomic heterogeneity in a Klebsiella pneumoniae strain isolated from a primary liver abscess. J Bacteriol. 190(2):515-26. [PMID:17981959] |