ICEberg
I. Information of ICE
ICEberg ID1093
Name ICESt2 This is a predicted ICE derived from literature
OrganismStreptococcus thermophilus CNRZ368
Size (bp)27250
GC content [Genome] (%)36.18
Insertion site-
Function-
Species that ICE can be transferred to-
Nucleotide SequenceAJ278471 (complete ICE sequence in this contig)
Replicon-
Coordinates8823..36049 
Putative oriT region coordinates: 15837..16049;   oriTDB id:  200004
CTAAAAATCAGGAATTGATAGCCTTGAATTGGGAAATTACTGTATTCAGAGGCTTTCACTATTTTATCAG
AATCATAAAGATAATAAACTATTAGAAGTTCCTCTAATTTATGCCACAAAGTTGATTCATAAAAATTATC
TTGACTTCCAATTTTATCAACAGAAACTGCGGTTATACTCATTGGCTCTTTCGCCTCTAAAGCATGTTTG
CTT
Putative relaxase -


II. ICE interaction with IME/CIME/

The Interaction Network among ICE/IME/CIME


Detailed Informatioin of the Interaction Network
# ICE  Inter_Ele [Type] Methods Donors Recipients Exper_Ref 
1ICESt2 CIME368 [CIME] experimentalin cis Streptococcus thermophilus Streptococcus thermophilus 15073287; 26104430

experimental This is an interactioin derived from experimental literature



The graph information of ICESt2 components from AJ278471
Complete gene list of ICESt2 from AJ278471
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)		 *Reannotation 
1-4728..5657 [+], 930putative carboxylate-amine/thiol ligase
2-5841..7016 [-], 1176putative transposase
3-9382..10515 [-], 1134putative ATP/GTP-binding protein
4-10516..11286 [-], 771hypothetical protein
5-11316..11339 [-], 24ORFV1 protein
6-11774..12199 [+], 426hypothetical protein
7-12382..14103 [-], 1722putative ATP/GTP-binding protein
8-14462..14767 [+], 306hypothetical protein
9sth368IR14837..16312 [-], 1476R.Sth368I endonuclease
10sth368IM16428..17693 [+], 1266M.Sth368I methyltransferase
11-17725..18024 [-], 300hypothetical protein
12arp118017..18715 [-], 699hypothetical transcriptional regulator
13-18724..19581 [-], 858hypothetical protein
14-19679..20995 [-], 1317hypothetical protein
15arp220985..21320 [-], 336hypothetical transcriptional regulator
16-22183..22479 [+], 297hypothetical protein
17-22501..22962 [+], 462hypothetical proteinOrfM; conjugative transfer; [PMID: 15073287] 
18-22976..24664 [+], 1689putative transfer proteinYdcQ, T4SS component 
19-24872..26104 [+], 1233putative transfer proteinOrfK; conjugative transfer; [PMID: 15073287] 
20-26119..26349 [+], 231hypothetical proteinOrfJ; conjugative transfer; [PMID: 15073287] 
21-26354..26911 [+], 558hypothetical protein
22ORFH26414..26911 [+], 498hypothetical proteinOrfH; conjugative transfer; [PMID: 15073287] 
23-26923..27918 [+], 996putative transfer proteinOrfG; conjugative transfer; [PMID: 15073287] 
24-27928..28152 [+], 225hypothetical proteinOrfF; conjugative transfer; [PMID: 15073287] 
25ORFE28155..28532 [+], 378putative transfer proteinYddD, T4SS component 
26-28578..31082 [+], 2505putative ATP/GTP-binding proteinYddE, T4SS component 
27-31094..32974 [+], 1881putative transmembrane proteinYddG, T4SS component 
28-32976..33200 [+], 225hypothetical protein
29-33226..34338 [+], 1113putative transfer proteinOrf13_p, T4SS component 
30xis34352..34600 [+], 249excisionaseexcisionase; [PMID: 15073287] 
31int34600..35946 [+], 1347integraseIntegrase 
32fda36030..36272 [-], 243putative fructose-1,6-biphosphate aldolase
 
flank Flanking regions

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins29Fasta
(1) Bellanger X; Morel C; Decaris B; Guedon G (2008). Regulation of excision of integrative and potentially conjugative elements from Streptococcus thermophilus: role of the arp1 repressor. J Mol Microbiol Biotechnol. 14(1-3):16-21. [PubMed:17957106] experimental
(2) Pavlovic G; Burrus V; Gintz B; Decaris B; Guedon G (2004). Evolution of genomic islands by deletion and tandem accretion by site-specific recombination: ICESt1-related elements from Streptococcus thermophilus. Microbiology. 150(Pt 4):759-74. [PubMed:15073287] experimental
 
experimental experimental literature

Genomics & Bioinformatics Group in MML, SJTU