ICEberg
I. Information of ICE
ICEberg ID1027
Name ICEPmiCHN3335 This ICE is derived from experimental literature
ICEO ID ICEO_0000150
OrganismProteus mirabilis TJ3335
Size (bp)89,996
GC content [Genome] (%)47.77
Insertion site-
FunctionResistance to azithromycin, chloramphenicol, kanamycin, streptomycin, trimethoprim-sulfamethoxazole, sulfamethoxazole, tetracycline
Species that ICE can be transferred to-
Nucleotide SequenceKX243416 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..89996 
Putative oriT region coordinates: 3685..3791;   oriTDB id:  200056
TATCGAGACGCCAAACAGTGATTGTGACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGA
TAGTGGTTTTGGCTTTAGGGGTTAATTGGATGGGGAA
Putative relaxase coordinates: 38317..40467; Gene: traI;  Family:  MOBH


II. ICE interaction with IME/CIME/

The interaction information of ICEPmiCHN3335 is not available.



The graph information of ICEPmiCHN3335 components from KX243416
Complete gene list of ICEPmiCHN3335 from KX243416
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)		 *Reannotation 
1-127..270 [-], 144hypothetical protein
2-615..809 [+], 195hypothetical protein
3int826..2067 [-], 1242integrase
4-2069..2338 [-], 270hypothetical protein
5-2341..3315 [-], 975Rod shape determination protein
6-3327..3578 [+], 252hypothetical protein
7-3780..4223 [+], 444hypothetical protein
8rumB4234..5406 [-], 1173Error-prone, lesion bypass DNA polymerase V (UmuC)
9tnp5690..6283 [+], 594Transposase
10tnpA6397..9375 [+], 2979Transposase
11tnpB9802..11286 [+], 1485Transposase
12-11488..12201 [+], 714Type IV secretory pathway, VirD2 components
13floR12418..13632 [+], 1215Bicyclomycin resistance proteinAR 
14-13660..13965 [+], 306LysR family transcriptional regulator
15tetA14232..15431 [-], 1200Tetracycline efflux protein TetAAR 
16tetR15510..16187 [+], 678Transcriptional regulator, TetR family
17-16219..16461 [-], 243Relaxase /helicase
18strB16767..17603 [-], 837streptomycin phosphotransferaseAR 
19strA17603..18406 [-], 804streptomycin phosphotransferaseAR 
20sul218467..19282 [-], 816Dihydropteroate synthaseAR 
21tnpI19655..19945 [+], 291Mobile element protein
22tnpII20011..20808 [+], 798Mobile element proteinIntegrase 
23mutL20819..21436 [-], 618MutL protein
24rumB22003..22272 [-], 270Error-prone, lesion bypass DNA polymerase V (UmuC)
25rumA22280..22729 [-], 450Error-prone repair protein UmuD
26-23371..24276 [+], 906DNA polymerase III
27-24364..24663 [+], 300hypothetical protein
28-24981..25934 [+], 954hypothetical protein
29-26015..27850 [+], 1836Type III restriction-modification system methylation subunit
30-27852..30503 [+], 2652Type III restriction-modification enzyme helicase subunit
31-30600..34481 [+], 3882hypothetical protein
32-34481..36907 [+], 2427hypothetical protein
33-36979..38160 [+], 1182putative inner membrane protein
34traI38317..40467 [+], 2151Conjugative transfer protein TraI, relaxaseRelaxase, MOBH Family
35traD40516..42336 [+], 1821IncF plasmid conjugative transfer protein TraDTraD_F, T4SS component 
36-42346..42906 [+], 561Conjugative transfer protein 234
37-42893..43528 [+], 636Conjugative transfer protein s043
38-43600..44238 [+], 639hypothetical protein
39-44231..45337 [+], 1107Transcriptional regulator
40traL45474..45755 [+], 282IncF plasmid conjugative transfer pilus assembly protein TraLTraL_F, T4SS component 
41traE45752..46378 [+], 627IncF plasmid conjugative transfer pilus assembly protein TraETraE_F, T4SS component 
42traK46362..47258 [+], 897IncF plasmid conjugative transfer pilus assembly protein TraKTraK_F, T4SS component 
43traB47261..48550 [+], 1290IncF plasmid conjugative transfer pilus assembly protein TraBTraB_F, T4SS component 
44traV48625..49197 [+], 573Conjugative transfer protein TraVTraV_F, T4SS component 
45traA49194..49580 [+], 387Conjugative transfer protein TraATraA_F, T4SS component 
46ynd49759..50592 [+], 834Ynd
47ync50585..51523 [+], 939Ync
48-51655..52347 [+], 693Thiol:disulfide involved in conjugative transferTrbB_I, T4SS component 
49traC52347..54746 [+], 2400IncF plasmid conjugative transfer pilus assembly protein TraCTraC_F, T4SS component 
50-54739..55086 [+], 348Conjugative transfer protein 345
51trhF55070..55582 [+], 513Conjugative signal peptidase TrhFTraF, T4SS component 
52traW55590..56717 [+], 1128IncF plasmid conjugative transfer pilus assembly protein TraWTraW_F, T4SS component 
53traU56749..57729 [+], 981IncF plasmid conjugative transfer pilus assembly protein TraUTraU_F, T4SS component 
54traN57732..61424 [+], 3693IncF plasmid conjugative transfer protein TraNTraN_F, T4SS component 
55-61883..63301 [+], 1419hypothetical protein
56herA63298..65337 [+], 2040Bipolar DNA helicase HerA
57-65583..65696 [+], 114hypothetical protein
58dns65746..66459 [-], 714Endonuclease I precursor
59-66462..66914 [-], 453Il-IS_2, transposase
60-67175..67777 [-], 603hypothetical protein
61-68144..68470 [+], 327hypothetical protein
62ssb68486..68905 [+], 420Single-stranded DNA-binding protein
63bet68985..69803 [+], 819Recombination protein BET
64-69886..70029 [+], 144hypothetical protein
65-70090..71106 [+], 1017hypothetical protein
66-71316..72275 [+], 960Aerobic cobaltochelatase CobS subunit
67-72275..73042 [+], 768hypothetical protein
68-73141..74094 [+], 954Cobalamine biosynthesis protein
69-74156..74596 [+], 441hypothetical protein
70-74666..76321 [+], 1656Plasmid associated gene product
71-76404..76901 [+], 498DNA repair protein RadC
72-76901..77242 [+], 342hypothetical protein
73-77334..78407 [+], 1074putative primase
74-78497..79201 [+], 705hypothetical protein
75traF79294..80238 [+], 945IncF plasmid conjugative transfer pilus assembly protein TraFTraF_F, T4SS component 
76traH80241..81629 [+], 1389IncF plasmid conjugative transfer pilus assembly protein TraHTraH_F, T4SS component 
77traG81633..85202 [+], 3570IncF plasmid conjugative transfer protein TraGTraG_F, T4SS component 
78eexS85235..85690 [-], 456EexS
79setC85724..86257 [-], 534Transcriptional activator
80setD86254..86553 [-], 300Transcriptional activator
81-86550..87098 [-], 549Soluble lytic murein transglycosylase and related regulatory proteinsOrf169_F, T4SS component 
82-87085..87747 [-], 663hypothetical protein
83-87734..88603 [-], 870hypothetical protein
84-88659..88910 [-], 252hypothetical protein
85setR89028..89675 [+], 648Putative cI prophage repressor protein
 

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins85Fasta
(1) Li X; Du Y; Du P; Dai H; Fang Y; Li Z; Lv N; Zhu B; Kan B; Wang D (2016). SXT/R391 integrative and conjugative elements in Proteus species reveal abundant genetic diversity and multidrug resistance. Sci Rep. 6:37372. [PubMed:27892525] experimental in_silico
 
experimental experimental literature
in_silico in silico analysis literature

Genomics & Bioinformatics Group in MML, SJTU