ICEberg ID | 1027 |
Name | ICEPmiCHN3335 |
ICEO ID | ICEO_0000150 |
Organism | Proteus mirabilis TJ3335 |
Size (bp) | 89,996 |
GC content [Genome] (%) | 47.77 |
Insertion site | - |
Function | Resistance to azithromycin, chloramphenicol, kanamycin, streptomycin, trimethoprim-sulfamethoxazole, sulfamethoxazole, tetracycline |
Species that ICE can be transferred to | - |
Nucleotide Sequence | KX243416 (complete ICE sequence in this GenBank file) |
Replicon | - |
Coordinates | 1..89996 |
Putative oriT region | coordinates: 3685..3791; oriTDB id: 200056 TATCGAGACGCCAAACAGTGATTGTGACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGA TAGTGGTTTTGGCTTTAGGGGTTAATTGGATGGGGAA |
Putative relaxase | coordinates: 38317..40467; Gene: traI; Family: MOBH |
The graph information of ICEPmiCHN3335 components from KX243416 | |||||
Complete gene list of ICEPmiCHN3335 from KX243416 | |||||
# | Gene | Coordinates [+/-], size (bp) | Product (GenBank annotation) | *Reannotation | |
1 | - | 127..270 [-], 144 | hypothetical protein | ||
2 | - | 615..809 [+], 195 | hypothetical protein | ||
3 | int | 826..2067 [-], 1242 | integrase | ||
4 | - | 2069..2338 [-], 270 | hypothetical protein | ||
5 | - | 2341..3315 [-], 975 | Rod shape determination protein | ||
6 | - | 3327..3578 [+], 252 | hypothetical protein | ||
7 | - | 3780..4223 [+], 444 | hypothetical protein | ||
8 | rumB | 4234..5406 [-], 1173 | Error-prone, lesion bypass DNA polymerase V (UmuC) | ||
9 | tnp | 5690..6283 [+], 594 | Transposase | ||
10 | tnpA | 6397..9375 [+], 2979 | Transposase | ||
11 | tnpB | 9802..11286 [+], 1485 | Transposase | ||
12 | - | 11488..12201 [+], 714 | Type IV secretory pathway, VirD2 components | ||
13 | floR | 12418..13632 [+], 1215 | Bicyclomycin resistance protein | AR | |
14 | - | 13660..13965 [+], 306 | LysR family transcriptional regulator | ||
15 | tetA | 14232..15431 [-], 1200 | Tetracycline efflux protein TetA | AR | |
16 | tetR | 15510..16187 [+], 678 | Transcriptional regulator, TetR family | ||
17 | - | 16219..16461 [-], 243 | Relaxase /helicase | ||
18 | strB | 16767..17603 [-], 837 | streptomycin phosphotransferase | AR | |
19 | strA | 17603..18406 [-], 804 | streptomycin phosphotransferase | AR | |
20 | sul2 | 18467..19282 [-], 816 | Dihydropteroate synthase | AR | |
21 | tnpI | 19655..19945 [+], 291 | Mobile element protein | ||
22 | tnpII | 20011..20808 [+], 798 | Mobile element protein | Integrase | |
23 | mutL | 20819..21436 [-], 618 | MutL protein | ||
24 | rumB | 22003..22272 [-], 270 | Error-prone, lesion bypass DNA polymerase V (UmuC) | ||
25 | rumA | 22280..22729 [-], 450 | Error-prone repair protein UmuD | ||
26 | - | 23371..24276 [+], 906 | DNA polymerase III | ||
27 | - | 24364..24663 [+], 300 | hypothetical protein | ||
28 | - | 24981..25934 [+], 954 | hypothetical protein | ||
29 | - | 26015..27850 [+], 1836 | Type III restriction-modification system methylation subunit | ||
30 | - | 27852..30503 [+], 2652 | Type III restriction-modification enzyme helicase subunit | ||
31 | - | 30600..34481 [+], 3882 | hypothetical protein | ||
32 | - | 34481..36907 [+], 2427 | hypothetical protein | ||
33 | - | 36979..38160 [+], 1182 | putative inner membrane protein | ||
34 | traI | 38317..40467 [+], 2151 | Conjugative transfer protein TraI, relaxase | Relaxase, MOBH Family | |
35 | traD | 40516..42336 [+], 1821 | IncF plasmid conjugative transfer protein TraD | TraD_F, T4SS component | |
36 | - | 42346..42906 [+], 561 | Conjugative transfer protein 234 | ||
37 | - | 42893..43528 [+], 636 | Conjugative transfer protein s043 | ||
38 | - | 43600..44238 [+], 639 | hypothetical protein | ||
39 | - | 44231..45337 [+], 1107 | Transcriptional regulator | ||
40 | traL | 45474..45755 [+], 282 | IncF plasmid conjugative transfer pilus assembly protein TraL | TraL_F, T4SS component | |
41 | traE | 45752..46378 [+], 627 | IncF plasmid conjugative transfer pilus assembly protein TraE | TraE_F, T4SS component | |
42 | traK | 46362..47258 [+], 897 | IncF plasmid conjugative transfer pilus assembly protein TraK | TraK_F, T4SS component | |
43 | traB | 47261..48550 [+], 1290 | IncF plasmid conjugative transfer pilus assembly protein TraB | TraB_F, T4SS component | |
44 | traV | 48625..49197 [+], 573 | Conjugative transfer protein TraV | TraV_F, T4SS component | |
45 | traA | 49194..49580 [+], 387 | Conjugative transfer protein TraA | TraA_F, T4SS component | |
46 | ynd | 49759..50592 [+], 834 | Ynd | ||
47 | ync | 50585..51523 [+], 939 | Ync | ||
48 | - | 51655..52347 [+], 693 | Thiol:disulfide involved in conjugative transfer | TrbB_I, T4SS component | |
49 | traC | 52347..54746 [+], 2400 | IncF plasmid conjugative transfer pilus assembly protein TraC | TraC_F, T4SS component | |
50 | - | 54739..55086 [+], 348 | Conjugative transfer protein 345 | ||
51 | trhF | 55070..55582 [+], 513 | Conjugative signal peptidase TrhF | TraF, T4SS component | |
52 | traW | 55590..56717 [+], 1128 | IncF plasmid conjugative transfer pilus assembly protein TraW | TraW_F, T4SS component | |
53 | traU | 56749..57729 [+], 981 | IncF plasmid conjugative transfer pilus assembly protein TraU | TraU_F, T4SS component | |
54 | traN | 57732..61424 [+], 3693 | IncF plasmid conjugative transfer protein TraN | TraN_F, T4SS component | |
55 | - | 61883..63301 [+], 1419 | hypothetical protein | ||
56 | herA | 63298..65337 [+], 2040 | Bipolar DNA helicase HerA | ||
57 | - | 65583..65696 [+], 114 | hypothetical protein | ||
58 | dns | 65746..66459 [-], 714 | Endonuclease I precursor | ||
59 | - | 66462..66914 [-], 453 | Il-IS_2, transposase | ||
60 | - | 67175..67777 [-], 603 | hypothetical protein | ||
61 | - | 68144..68470 [+], 327 | hypothetical protein | ||
62 | ssb | 68486..68905 [+], 420 | Single-stranded DNA-binding protein | ||
63 | bet | 68985..69803 [+], 819 | Recombination protein BET | ||
64 | - | 69886..70029 [+], 144 | hypothetical protein | ||
65 | - | 70090..71106 [+], 1017 | hypothetical protein | ||
66 | - | 71316..72275 [+], 960 | Aerobic cobaltochelatase CobS subunit | ||
67 | - | 72275..73042 [+], 768 | hypothetical protein | ||
68 | - | 73141..74094 [+], 954 | Cobalamine biosynthesis protein | ||
69 | - | 74156..74596 [+], 441 | hypothetical protein | ||
70 | - | 74666..76321 [+], 1656 | Plasmid associated gene product | ||
71 | - | 76404..76901 [+], 498 | DNA repair protein RadC | ||
72 | - | 76901..77242 [+], 342 | hypothetical protein | ||
73 | - | 77334..78407 [+], 1074 | putative primase | ||
74 | - | 78497..79201 [+], 705 | hypothetical protein | ||
75 | traF | 79294..80238 [+], 945 | IncF plasmid conjugative transfer pilus assembly protein TraF | TraF_F, T4SS component | |
76 | traH | 80241..81629 [+], 1389 | IncF plasmid conjugative transfer pilus assembly protein TraH | TraH_F, T4SS component | |
77 | traG | 81633..85202 [+], 3570 | IncF plasmid conjugative transfer protein TraG | TraG_F, T4SS component | |
78 | eexS | 85235..85690 [-], 456 | EexS | ||
79 | setC | 85724..86257 [-], 534 | Transcriptional activator | ||
80 | setD | 86254..86553 [-], 300 | Transcriptional activator | ||
81 | - | 86550..87098 [-], 549 | Soluble lytic murein transglycosylase and related regulatory proteins | Orf169_F, T4SS component | |
82 | - | 87085..87747 [-], 663 | hypothetical protein | ||
83 | - | 87734..88603 [-], 870 | hypothetical protein | ||
84 | - | 88659..88910 [-], 252 | hypothetical protein | ||
85 | setR | 89028..89675 [+], 648 | Putative cI prophage repressor protein |
(1) Li X; Du Y; Du P; Dai H; Fang Y; Li Z; Lv N; Zhu B; Kan B; Wang D (2016). SXT/R391 integrative and conjugative elements in Proteus species reveal abundant genetic diversity and multidrug resistance. Sci Rep. 6:37372. [PubMed:27892525] |
experimental literature |
in silico analysis literature |