Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 400007
• Name: oriT_ICESt3cat
• Sequence Completeness: intact
• NCBI accession of oriT (coordinates [strand]): -
• oriT length: 213 nt
• IRs (inverted repeats): 1..8, 12..19 (GCCTGACC..GGTCAGGC) 61..67, 80..86 ( AACCCCC..GGGGGTT) 154..159, 163..168 ( AAAGTG..CACTTT) 177..181, 185..189 ( AAGTG..CACTT)
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: oriT_ICESt3

oriT sequence

• Length: 213 nt

>oriT_ICESt3cat
GCCTGACCACAGGTCAGGCGCAGACCGTAGCCCGAAGTTCCTAGGCCATGATGAGACTTCAACCCCCGATTTCTAATAGGGGGGTTACATTTGGCCAAAGTGCCACGTCCACCCCTCCTCATTCCTTGTGGGAGTTGGGATTTCAAGATTTAGAAAGTGTGTCACTTTGGTCCAAAAAGTGTGTCACTTAGTCAAAAGGAGGTGTTCCCATGA

oriT secondary structure

Predicted by RNAfold.

Reference

[1] Ceccarelli D et al. (2008) Identification of the origin of transfer (oriT) and a new gene required for mobilization of the SXT/R391 family of integrating conjugative elements. J Bacteriol. 190(15):5328-38. [PMID:18539733]

Host bacterium

• ID: 62
• Element name: ICESt3cat
• GenBank: _
• Element size: _
• Coordinate of oriT [Strand]: _

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -